Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6150
Trapped Gene
Copb2 (ENSMUSG00000032458)
Vector Insertion
Chr 9: 98474585 - 98477376
Public Clones CSG040 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230701 (Chr9:98474485..98474584 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATCATCATCACAGGGTCA Chr9:98474558..98474577 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230701 (Chr9:98474485..98474584 +)
Downstram Exon
ENSMUSE00000230688 (Chr9:98477377..98477519 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATCATCATCACAGGGTCA Chr9:98474558..98474577 60.34 50 CGTAATTCAGCGTGCTCTCA Chr9:98477436..98477455 60.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693674 Chr9:98464150..98464242 GTGGGTTCCTGAGTGTGTCG Chr9:98464175..98464194 61.61 60
upstream ENSMUSE00000230780 Chr9:98468412..98468549 GACCGAGTTAAGAGCGTGGA Chr9:98468454..98468473 60.4 55
upstream ENSMUSE00000219829 Chr9:98470725..98470811 AAGAACTGGGTGGTGACAGG Chr9:98470788..98470807 60 55
upstream ENSMUSE00000219824 Chr9:98471002..98471128 GCACACTCGGATTACATTCGT Chr9:98471062..98471082 60.01 47.62
upstream ENSMUSE00000219818 Chr9:98471913..98472061 GCATCTCTCGACAGGACCAT Chr9:98472038..98472057 60.23 55
upstream ENSMUSE00000219832 Chr9:98473854..98474000 GAAAAAGGCGTGAATTGCAT Chr9:98473902..98473921 60.08 40
upstream ENSMUSE00000230701 Chr9:98474485..98474584 CCATCATCATCACAGGGTCA Chr9:98474558..98474577 60.34 50

*** Putative Vector Insertion (Chr 9: 98474585 - 98477376) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230688 Chr9:98477377..98477519 CGTAATTCAGCGTGCTCTCA Chr9:98477436..98477455 60.16 50
downstream ENSMUSE00000230670 Chr9:98477747..98477946 TTGTGCTGAATGGTCTGTGG Chr9:98477937..98477956 60.72 50
downstream ENSMUSE00000219817 Chr9:98479400..98479510 CAGACCCGAAGCTCTTGTTC Chr9:98479479..98479498 59.99 55
downstream ENSMUSE00000219821 Chr9:98480501..98480589 CAGCTCCAAAATCGGGTTTA Chr9:98480589..98480608 60.07 45
downstream ENSMUSE00000219823 Chr9:98480677..98480783 AGCAAGAAGCCCCCATAGAT Chr9:98480701..98480720 60.06 50
downstream ENSMUSE00000219819 Chr9:98481554..98481697 GGCGATACAGACCAGCTCTC Chr9:98481595..98481614 59.98 60
downstream ENSMUSE00000219828 Chr9:98482691..98482821 AGCAGTCACCTACCCACAGC Chr9:98482748..98482767 60.33 60
downstream ENSMUSE00000230534 Chr9:98483109..98483316 GGACTTTATCCGCCATGCTA Chr9:98483263..98483282 60.06 50
downstream ENSMUSE00000219820 Chr9:98485402..98485512 TGAAGAGCAAGCTCAAAACG Chr9:98485469..98485488 59.34 45
downstream ENSMUSE00000219833 Chr9:98486351..98486565 CCACGTTATTTTTGCCGTCT Chr9:98486540..98486559 60 45
downstream ENSMUSE00000219830 Chr9:98487459..98487551 AGTAAGTTCGGGCCAGGAAG Chr9:98487535..98487554 60.62 55
downstream ENSMUSE00000230437 Chr9:98487644..98487824 AATCCGCATGTGTCTCCTTC Chr9:98487795..98487814 60.08 50
downstream ENSMUSE00000230412 Chr9:98487971..98488039 GAAAGCCTTTTGCCTCTTCC Chr9:98488016..98488035 60.32 50
downstream ENSMUSE00000230387 Chr9:98488180..98488248 GAAGCAGGTTTTCCATCAGG Chr9:98488205..98488224 59.67 50
downstream ENSMUSE00000634853 Chr9:98488464..98488794 GGCTATGTTCCCCCTTGTTT Chr9:98488676..98488695 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGATGTGCTGCTCATGACT Chr9:98474604..98474624 60.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGATGTGCTGCTCATGACT Chr9:98474604..98474624 60.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032458