Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6152
Trapped Gene
Tbc1d19 (ENSMUSG00000039178)
Vector Insertion
Chr 5: 54280647 - 54288229
Public Clones CSG050 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000278352 (Chr5:54280555..54280646 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGAAATTGGAGCTCAACC Chr5:54280627..54280646 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000278352 (Chr5:54280555..54280646 +)
Downstram Exon
ENSMUSE00000278342 (Chr5:54288230..54288345 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGAAATTGGAGCTCAACC Chr5:54280627..54280646 59.81 50 GAAAAAGCTCGAACCATCCA Chr5:54288271..54288290 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352068 Chr5:54200915..54201097 CCCAGATCGTCCAGAAACTC Chr5:54201036..54201055 59.65 55
upstream ENSMUSE00000278491 Chr5:54220589..54220661 GACCCGAGATCAGACTCGAA Chr5:54220602..54220621 60.35 55
upstream ENSMUSE00000278480 Chr5:54221694..54221739 No primer for this exon
upstream ENSMUSE00000278472 Chr5:54224209..54224284 TCCTTTGCCAAGTCATCCTT Chr5:54224212..54224231 59.67 45
upstream ENSMUSE00000278462 Chr5:54226411..54226485 TGAGTATCCCACTAGCACGAAA Chr5:54226463..54226484 59.77 45.46
upstream ENSMUSE00000278452 Chr5:54227835..54227898 GAATGAGATGGGAACGGATG Chr5:54227873..54227892 60.28 50
upstream ENSMUSE00000278445 Chr5:54229163..54229209 CCCGTTTATGCACCTAAGGA Chr5:54229180..54229199 59.95 50
upstream ENSMUSE00000278437 Chr5:54229366..54229476 AATCTCCGCAACCCAAATTA Chr5:54229375..54229394 59.41 40
upstream ENSMUSE00000278428 Chr5:54237440..54237512 No primer for this exon
upstream ENSMUSE00000278422 Chr5:54239401..54239439 No primer for this exon
upstream ENSMUSE00000278416 Chr5:54241077..54241189 GCTCAGCAGTACATCCGACA Chr5:54241103..54241122 60.02 55
upstream ENSMUSE00000278407 Chr5:54248087..54248161 GTGATCCAGCACGACCTTTT Chr5:54248120..54248139 60.12 50
upstream ENSMUSE00000278396 Chr5:54251383..54251445 GAAGCTGACAGCAAGCAATG Chr5:54251388..54251407 59.75 50
upstream ENSMUSE00000278388 Chr5:54263492..54263576 CGCCGAAGTCATACATCAGA Chr5:54263556..54263575 59.82 50
upstream ENSMUSE00000278377 Chr5:54266126..54266170 TGTTTTCTATCCGCCCAATG Chr5:54266151..54266170 60.83 45
upstream ENSMUSE00000278367 Chr5:54274901..54274933 ATCCCTTTCCATGGGTTTTC Chr5:54274906..54274925 60 45
upstream ENSMUSE00000278360 Chr5:54278593..54278702 CGTCCGCTTTTTCTTCAGAC Chr5:54278657..54278676 59.99 50
upstream ENSMUSE00000278352 Chr5:54280555..54280646 CGAGAAATTGGAGCTCAACC Chr5:54280627..54280646 59.81 50

*** Putative Vector Insertion (Chr 5: 54280647 - 54288229) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000278342 Chr5:54288230..54288345 GAAAAAGCTCGAACCATCCA Chr5:54288271..54288290 60.19 45
downstream ENSMUSE00000278332 Chr5:54292816..54292886 CCTCCATCAGGTTCACTGCT Chr5:54292866..54292885 60.26 55
downstream ENSMUSE00000406700 Chr5:54294571..54294744 TCAGGTGACGGTAGCAAACA Chr5:54294648..54294667 60.3 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTGTCCCACTGCATCTTG Chr5:54286659..54286679 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTGTCCCACTGCATCTTG Chr5:54286659..54286679 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039178