Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6165
Trapped Gene
Rps6kb1 (ENSMUSG00000020516)
Vector Insertion
Chr 11: 86333542 - 86346273
Public Clones CSG121 (baygenomics)
Private Clones OST190950 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381972 (Chr11:86346274..86346342 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381972 (Chr11:86346274..86346342 -)
Downstram Exon
ENSMUSE00000577873 (Chr11:86333394..86333541 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335550 Chr11:86358068..86358276 No primer for this exon
upstream ENSMUSE00000710676 Chr11:86358068..86358276 No primer for this exon
upstream ENSMUSE00000384714 Chr11:86348913..86348962 No primer for this exon
upstream ENSMUSE00000407034 Chr11:86347528..86347648 No primer for this exon
upstream ENSMUSE00000381972 Chr11:86346274..86346342 No primer for this exon

*** Putative Vector Insertion (Chr 11: 86333542 - 86346273) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577873 Chr11:86333394..86333541 No primer for this exon
downstream ENSMUSE00000105593 Chr11:86331085..86331142 No primer for this exon
downstream ENSMUSE00000459887 Chr11:86330852..86330894 No primer for this exon
downstream ENSMUSE00000459878 Chr11:86330653..86330751 No primer for this exon
downstream ENSMUSE00000675298 Chr11:86330268..86330489 No primer for this exon
downstream ENSMUSE00000459869 Chr11:86330246..86330489 No primer for this exon
downstream ENSMUSE00000473997 Chr11:86329593..86329693 No primer for this exon
downstream ENSMUSE00000489159 Chr11:86327485..86329693 No primer for this exon
downstream ENSMUSE00000577872 Chr11:86327049..86327139 No primer for this exon
downstream ENSMUSE00000105586 Chr11:86326802..86326892 No primer for this exon
downstream ENSMUSE00000105589 Chr11:86326308..86326415 No primer for this exon
downstream ENSMUSE00000105580 Chr11:86325327..86325389 No primer for this exon
downstream ENSMUSE00000105578 Chr11:86325091..86325168 No primer for this exon
downstream ENSMUSE00000577871 Chr11:86320293..86320400 No primer for this exon
downstream ENSMUSE00000105582 Chr11:86317768..86317880 No primer for this exon
downstream ENSMUSE00000586520 Chr11:86316064..86316464 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCTTGAACTGGGCACCTG Chr11:86340252..86340272 60.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTGTCGTGACTGGGAAAAC Chr11:86340207..86340228 60.6 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020516