Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6174
Trapped Gene
Rps15 (ENSMUSG00000063457)
Vector Insertion
Chr 10: 79755606 - 79756386
Public Clones (sanger) (sanger) CSG140 (baygenomics) CMHD-GT_269D5-3 (cmhd) IST10727D6 (tigm)
IST11635G9 (tigm)
Private Clones OST369044 (lexicon) OST352210 (lexicon) OST318398 (lexicon) OST284047 (lexicon)
OST258783 (lexicon) OST239781 (lexicon) OST206239 (lexicon) OST115643 (lexicon)
OST115641 (lexicon) OST115639 (lexicon) OST20044 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665944 (Chr10:79755390..79755605 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCGCAAGTTCACCTACC Chr10:79755549..79755568 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665944 (Chr10:79755390..79755605 +)
Downstram Exon
ENSMUSE00000574856 (Chr10:79756387..79756621 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCGCAAGTTCACCTACC Chr10:79755549..79755568 59.73 55 GTTGAAGGTCTTGCCGTTGT Chr10:79756609..79756628 60.16 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665948 Chr10:79755204..79755228 No primer for this exon
upstream ENSMUSE00000665944 Chr10:79755390..79755605 CTTCCGCAAGTTCACCTACC Chr10:79755549..79755568 59.73 55
upstream ENSMUSE00000665947 Chr10:79755520..79755605 CTTCCGCAAGTTCACCTACC Chr10:79755549..79755568 59.73 55

*** Putative Vector Insertion (Chr 10: 79755606 - 79756386) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000574856 Chr10:79756387..79756621 GTTGAAGGTCTTGCCGTTGT Chr10:79756609..79756628 60.16 50
downstream ENSMUSE00000424321 Chr10:79756712..79756857 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50
downstream ENSMUSE00000665943 Chr10:79756712..79756832 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50
downstream ENSMUSE00000665946 Chr10:79756712..79756720 No primer for this exon
downstream ENSMUSE00000665945 Chr10:79756784..79756825 TACTTGAGGGGGATGAATCG Chr10:79756827..79756846 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTAGACCTCGACCAACTGC Chr10:79755574..79755594 60.85 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTAGACCTCGACCAACTGC Chr10:79755574..79755594 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063457