Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6192
Trapped Gene
Wdr44 (ENSMUSG00000036769)
Vector Insertion
Chr X: 23347123 - 23355749
Public Clones CSG199 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000451736 (ChrX:23347016..23347122 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCAAAGCATCTTGCTGAG ChrX:23347053..23347073 59.91 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000451736 (ChrX:23347016..23347122 +)
Downstram Exon
ENSMUSE00000451730 (ChrX:23355750..23355901 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCAAAGCATCTTGCTGAG ChrX:23347053..23347073 59.91 47.62 AACCATGTGCTGCCTTGAAT ChrX:23355842..23355861 60.53 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451825 ChrX:23270243..23270665 TATAAATGGCGTCGGAAAGC ChrX:23270584..23270603 60.06 45
upstream ENSMUSE00000656528 ChrX:23270284..23270395 GCCTCTTCTCTAGCGCTCTC ChrX:23270303..23270322 58.67 60
upstream ENSMUSE00000656527 ChrX:23270551..23270665 TATAAATGGCGTCGGAAAGC ChrX:23270584..23270603 60.06 45
upstream ENSMUSE00000514819 ChrX:23309444..23309477 No primer for this exon
upstream ENSMUSE00000318595 ChrX:23327032..23327106 AGCCGAGAATACAGCAAACC ChrX:23327034..23327053 59.34 50
upstream ENSMUSE00000656526 ChrX:23333566..23334211 ACCCCCACCAACTAATTTCC ChrX:23334093..23334112 59.92 50
upstream ENSMUSE00000656525 ChrX:23335221..23335351 CCTGCCTTCCCTCGATTTAG ChrX:23335294..23335313 61.07 55
upstream ENSMUSE00000451757 ChrX:23336309..23336404 GCACCTGATGTGCAGACAGTA ChrX:23336321..23336341 59.92 52.38
upstream ENSMUSE00000451748 ChrX:23338530..23338666 CTGCACATCATGAGAAGGACA ChrX:23338632..23338652 59.85 47.62
upstream ENSMUSE00000451742 ChrX:23339403..23339486 CAATGATGCCACACAGTCAG ChrX:23339403..23339422 58.65 50
upstream ENSMUSE00000451736 ChrX:23347016..23347122 AGAGCAAAGCATCTTGCTGAG ChrX:23347053..23347073 59.91 47.62

*** Putative Vector Insertion (Chr X: 23347123 - 23355749) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000451730 ChrX:23355750..23355901 AACCATGTGCTGCCTTGAAT ChrX:23355842..23355861 60.53 45
downstream ENSMUSE00000451726 ChrX:23357929..23358067 CGGCCACAGTGAGAAAACTT ChrX:23357969..23357988 60.29 50
downstream ENSMUSE00000451492 ChrX:23360414..23360478 TTTCCTGAGATGGTGAAGGTG ChrX:23360445..23360465 60.1 47.62
downstream ENSMUSE00000451489 ChrX:23365178..23365291 TCTGGGTCTTCGTCAGTTCC ChrX:23365209..23365228 60.24 55
downstream ENSMUSE00000451484 ChrX:23373110..23373232 AGCGATGGCAGTGACAAAAT ChrX:23373223..23373242 60.67 45
downstream ENSMUSE00000451480 ChrX:23377496..23377687 TCCATCCAATGATCCACTGA ChrX:23377534..23377553 59.85 45
downstream ENSMUSE00000451478 ChrX:23377860..23377961 CAACCTTGTTGCGTCCTCTA ChrX:23377920..23377939 58.92 50
downstream ENSMUSE00000393387 ChrX:23378166..23378281 CTTGCTTTGATCTGGCTGCT ChrX:23378278..23378297 60.68 50
downstream ENSMUSE00000334346 ChrX:23379441..23379568 TTCTGAACCGCTAACGAGGT ChrX:23379477..23379496 59.88 50
downstream ENSMUSE00000451470 ChrX:23380895..23381029 TTCAGATTGCACATCCAAGG ChrX:23380974..23380993 59.65 45
downstream ENSMUSE00000451785 ChrX:23382015..23383116 ACCCAGTAGGAGGCCAAAAG ChrX:23382498..23382517 60.49 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTTAATCGCCTTGCAGCAC ChrX:23353170..23353191 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTATTCGTGACTGGGAAAACC ChrX:23353169..23353190 58.42 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036769