Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6196
Trapped Gene
Polr2c (ENSMUSG00000031783)
Vector Insertion
Chr 8: 97381697 - 97384143
Public Clones CSG212 (baygenomics) IST14631F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212934 (Chr8:97381647..97381696 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTCCATTCGGAGGGTCTTC Chr8:97381655..97381674 60.27 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212934 (Chr8:97381647..97381696 +)
Downstram Exon
ENSMUSE00000212935 (Chr8:97384144..97384212 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTCCATTCGGAGGGTCTTC Chr8:97381655..97381674 60.27 50 AGTTGGCGTCAATCTGAACC Chr8:97384176..97384195 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000287902 Chr8:97381421..97381541 GGAACTCACCGAAGAGAACG Chr8:97381491..97381510 59.84 55
upstream ENSMUSE00000212934 Chr8:97381647..97381696 ATTCCATTCGGAGGGTCTTC Chr8:97381655..97381674 60.27 50

*** Putative Vector Insertion (Chr 8: 97381697 - 97384143) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212935 Chr8:97384144..97384212 AGTTGGCGTCAATCTGAACC Chr8:97384176..97384195 60.12 50
downstream ENSMUSE00000212932 Chr8:97384344..97384396 TGCAGCTTGTCCACAATGTC Chr8:97384389..97384408 60.88 50
downstream ENSMUSE00000358569 Chr8:97385611..97385739 GATGAGATCTCGGGAGGTGA Chr8:97385718..97385737 60.16 55
downstream ENSMUSE00000580859 Chr8:97386082..97386133 TAGGGTCGTTATCCCGGTTC Chr8:97386115..97386134 61.06 55
downstream ENSMUSE00000287800 Chr8:97386421..97386589 TCTTGGCATAGGCTCGAAGT Chr8:97386483..97386502 59.98 50
downstream ENSMUSE00000287771 Chr8:97386710..97386784 CCTCATCCAGCTCGGAATAC Chr8:97386744..97386763 59.65 55
downstream ENSMUSE00000680616 Chr8:97387352..97387811 AAACCCGCCATGTCTAACAC Chr8:97387656..97387675 59.86 50
downstream ENSMUSE00000635015 Chr8:97391262..97391393 CTGATGAGAAGTCCGTGTGC Chr8:97391332..97391351 59.42 55
downstream ENSMUSE00000635014 Chr8:97394408..97394589 TCCCCGCTATTGTTGAAGTT Chr8:97394509..97394528 59.57 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031783