Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6212
Trapped Gene
Dlg1 (ENSMUSG00000022770)
Vector Insertion
Chr 16: 31868009 - 31871760
Public Clones CSG281 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230745 (Chr16:31867917..31868008 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAATGAACAAGCGCCTAA Chr16:31867917..31867936 60.21 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230745 (Chr16:31867917..31868008 +)
Downstram Exon
ENSMUSE00000702038 (Chr16:31871761..31871932 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAATGAACAAGCGCCTAA Chr16:31867917..31867936 60.21 45 AAATGTCCTCCAGCGTGTCT Chr16:31871796..31871815 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434992 Chr16:31663529..31663574 GTGAGGGGTGTCTTGAGCTT Chr16:31663534..31663553 59.31 55
upstream ENSMUSE00000644422 Chr16:31663995..31664407 No primer for this exon
upstream ENSMUSE00000434707 Chr16:31664125..31664407 No primer for this exon
upstream ENSMUSE00000702035 Chr16:31664236..31664407 No primer for this exon
upstream ENSMUSE00000334814 Chr16:31664907..31664956 No primer for this exon
upstream ENSMUSE00000709094 Chr16:31664907..31664956 No primer for this exon
upstream ENSMUSE00000375424 Chr16:31665661..31665792 AGAGCATTGCATCTGTTGGA Chr16:31665669..31665688 59.4 45
upstream ENSMUSE00000230857 Chr16:31684214..31684380 GTGAACCAGTTCAGCCTGTG Chr16:31684280..31684299 59.31 55
upstream ENSMUSE00000130290 Chr16:31743192..31743356 CCGGTATCAGGATGAAGAGGT Chr16:31743197..31743217 60.33 52.38
upstream ENSMUSE00000702027 Chr16:31754436..31755102 AAGGGTCTTGGTAGCCCAGT Chr16:31754461..31754480 59.99 55
upstream ENSMUSE00000130294 Chr16:31771843..31771941 GCCAGTCCCTGCTGAGAGTA Chr16:31771896..31771915 60.56 60
upstream ENSMUSE00000702029 Chr16:31771843..31772010 GCCAGTCCCTGCTGAGAGTA Chr16:31771896..31771915 60.56 60
upstream ENSMUSE00000130301 Chr16:31781868..31781921 TGCTGGTCAACACAGACAGC Chr16:31781884..31781903 61.1 55
upstream ENSMUSE00000130286 Chr16:31788168..31788218 TGGCACTGATGCAGATTATGA Chr16:31788173..31788193 60.24 42.86
upstream ENSMUSE00000130284 Chr16:31790263..31790387 GGAAATTCGGGTCTTGGTTT Chr16:31790263..31790282 60.17 45
upstream ENSMUSE00000130288 Chr16:31791801..31791970 GTATGTGAAAAGGCGGAAGC Chr16:31791903..31791922 59.71 50
upstream ENSMUSE00000130298 Chr16:31793590..31793726 GGCAAGCTTCAGATTGGAGA Chr16:31793694..31793713 60.48 50
upstream ENSMUSE00000130296 Chr16:31796952..31797096 GCTATGCACCACCTGACATC Chr16:31797070..31797089 59.12 55
upstream ENSMUSE00000130283 Chr16:31805700..31805820 GTGCTCGGAGATGACGAGAT Chr16:31805795..31805814 60.38 55
upstream ENSMUSE00000230817 Chr16:31812754..31812910 TCTTCATCGTGGCTCAACAG Chr16:31812772..31812791 59.98 50
upstream ENSMUSE00000230810 Chr16:31829552..31829654 GAGCTGCAAGTCACGAACAA Chr16:31829571..31829590 60.18 50
upstream ENSMUSE00000230805 Chr16:31836276..31836390 CTCTTCGAACCAGCCAGAAG Chr16:31836354..31836373 60.13 55
upstream ENSMUSE00000230798 Chr16:31838136..31838312 TCAATGCTTCTGACGACGAG Chr16:31838222..31838241 60.14 50
upstream ENSMUSE00000230790 Chr16:31842856..31842925 AGGAACGAGCCCGATTAAAA Chr16:31842867..31842886 60.92 45
upstream ENSMUSE00000511839 Chr16:31846920..31847019 TTCCCGAAAATTTCCCTTCT Chr16:31846955..31846974 59.88 40
upstream ENSMUSE00000702050 Chr16:31846923..31847019 TTCCCGAAAATTTCCCTTCT Chr16:31846955..31846974 59.88 40
upstream ENSMUSE00000434693 Chr16:31847722..31847755 GACGACATGGGATCAAAAGG Chr16:31847731..31847750 60.32 50
upstream ENSMUSE00000230778 Chr16:31853929..31853970 No primer for this exon
upstream ENSMUSE00000702026 Chr16:31854739..31854774 No primer for this exon
upstream ENSMUSE00000702039 Chr16:31854754..31854774 No primer for this exon
upstream ENSMUSE00000230770 Chr16:31856527..31856577 TGAGCCAGTGAATCAACAAGA Chr16:31856555..31856575 59.43 42.86
upstream ENSMUSE00000521165 Chr16:31857633..31857734 No primer for this exon
upstream ENSMUSE00000559866 Chr16:31857978..31858150 GAAGCCGGCCAGTATAACAA Chr16:31858082..31858101 60.1 50
upstream ENSMUSE00000230750 Chr16:31863259..31863368 AGAGGTTGCAGATTGCACAG Chr16:31863299..31863318 59.04 50
upstream ENSMUSE00000230745 Chr16:31867917..31868008 GGAAATGAACAAGCGCCTAA Chr16:31867917..31867936 60.21 45

*** Putative Vector Insertion (Chr 16: 31868009 - 31871760) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434713 Chr16:31871761..31872347 CTGGTCAGGCCATTCATCTT Chr16:31872090..31872109 60.07 50
downstream ENSMUSE00000702033 Chr16:31871761..31872770 GGGAGGGCACACAATAAAGA Chr16:31872459..31872478 59.93 50
downstream ENSMUSE00000702038 Chr16:31871761..31871932 AAATGTCCTCCAGCGTGTCT Chr16:31871796..31871815 59.73 50
downstream ENSMUSE00000702048 Chr16:31871761..31873436 TGCCAAAATCACGTATCGAA Chr16:31873339..31873358 60.07 40
downstream ENSMUSE00000702054 Chr16:31871761..31873428 TGCCAAAATCACGTATCGAA Chr16:31873339..31873358 60.07 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCTGGAGCAGGAGTTCA Chr16:31867975..31867995 60.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCTGGAGCAGGAGTTCA Chr16:31867975..31867995 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022770