Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6239
Trapped Gene
Sall1 (ENSMUSG00000031665)
Vector Insertion
Chr 8: 91557298 - 91566250
Public Clones (sanger) (sanger) CSG464 (baygenomics) D142D01 (ggtc) E140G05 (ggtc)
E067B05 (ggtc) D124C03 (ggtc) E140G05 (ggtc) D152B09 (ggtc) E067B05 (ggtc)
IST11229G2 (tigm) IST12587C5 (tigm) IST10122A11BBR1 (tigm) IST12318F12 (tigm)
IST12506C5 (tigm) IST13321E2 (tigm) IST10122D12 (tigm) IST10122C11 (tigm)
IST10654H10 (tigm) IST14793B10 (tigm) IST14810B2 (tigm) IST12587C5 (tigm)
IST10122B11BBR1 (tigm) IST15052E12 (tigm) IST13010D6 (tigm) IST10122D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000243454 (Chr8:91566251..91566343 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCGAAGCCTCAACATTT Chr8:91566292..91566311 60.39 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000243454 (Chr8:91566251..91566343 -)
Downstram Exon
ENSMUSE00000211596 (Chr8:91553843..91557297 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCGAAGCCTCAACATTT Chr8:91566292..91566311 60.39 45 GGGGTGGGAGATAGACCATT Chr8:91554464..91554483 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488541 Chr8:91567929..91568061 AACTAAGCCGAGGACCAAGC Chr8:91567998..91568017 60.76 55
upstream ENSMUSE00000243454 Chr8:91566251..91566343 CAAGCGAAGCCTCAACATTT Chr8:91566292..91566311 60.39 45

*** Putative Vector Insertion (Chr 8: 91557298 - 91566250) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211596 Chr8:91553843..91557297 GGGGTGGGAGATAGACCATT Chr8:91554464..91554483 60.01 55
downstream ENSMUSE00000243441 Chr8:91551147..91552717 CAGAGATCTCGTTGGCCTTC Chr8:91552470..91552489 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTAATCGCCTTGCAGCACA Chr8:91557278..91557298 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAAACTGGGATTGTGGTG Chr8:91566237..91566257 59.39 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AACCCTGCACCTTTTGATGT Chr8:91557302..91557322 59.45 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACCCTGCACCTTTTGATGT Chr8:91557302..91557322 59.45 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031665