Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI625
Trapped Gene
Morc3 (ENSMUSG00000039456)
Vector Insertion
Chr 16: 93832594 - 93841615
Public Clones AY0345 (sanger) (sanger) AD0408 (sanger) BGB160 (baygenomics) M053A07 (ggtc)
E132B12 (ggtc) IST15052F6 (tigm) IST12032D11 (tigm) IST12032D11 (tigm)
Private Clones OST371059 (lexicon) OST196570 (lexicon) OST170759 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000616643 (Chr16:93832529..93832593 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTTTGTAGCTCACTCAAGA Chr16:93832534..93832555 60.19 45.46 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000616643 (Chr16:93832529..93832593 +)
Downstram Exon
ENSMUSE00000433413 (Chr16:93841616..93841688 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTTTGTAGCTCACTCAAGA Chr16:93832534..93832555 60.19 45.46 ACTGAACGGCCAGGTATGAC Chr16:93841672..93841691 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000616643 Chr16:93832529..93832593 TGGCTTTGTAGCTCACTCAAGA Chr16:93832534..93832555 60.19 45.46

*** Putative Vector Insertion (Chr 16: 93832594 - 93841615) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000433413 Chr16:93841616..93841688 ACTGAACGGCCAGGTATGAC Chr16:93841672..93841691 60 55
downstream ENSMUSE00000422774 Chr16:93844439..93844571 CCGTTGCCATTATCAGTGAA Chr16:93844541..93844560 59.54 45
downstream ENSMUSE00000433402 Chr16:93845385..93845598 CCATTCCCGTACAATCCAAC Chr16:93845450..93845469 60.05 50
downstream ENSMUSE00000472782 Chr16:93847527..93847675 GAATTGCTGCTAGGCTTGCT Chr16:93847578..93847597 59.76 50
downstream ENSMUSE00000555436 Chr16:93849375..93849522 GTCACTCTCAGGGGCAATTT Chr16:93849513..93849532 59.14 50
downstream ENSMUSE00000555430 Chr16:93853334..93853462 No primer for this exon
downstream ENSMUSE00000555428 Chr16:93854024..93854143 TTCTGCAGTTGAATCCAAAAGT Chr16:93854064..93854085 58.88 36.36
downstream ENSMUSE00000555425 Chr16:93855661..93855758 AACCACTCCAACACCCATGT Chr16:93855690..93855709 60.13 50
downstream ENSMUSE00000555423 Chr16:93860738..93860842 CGACTGGCAAGTTTACAGGA Chr16:93860835..93860854 58.92 50
downstream ENSMUSE00000555421 Chr16:93862659..93862781 CTGTGGGTCAGGGTTATTGG Chr16:93862779..93862798 60.22 55
downstream ENSMUSE00000555419 Chr16:93862886..93862960 GGTTCTTCCGGAACTTCACA Chr16:93862912..93862931 60.09 50
downstream ENSMUSE00000555417 Chr16:93865205..93865262 GAGGATTTCCGGTTGTCTGA Chr16:93865247..93865266 60.05 50
downstream ENSMUSE00000358240 Chr16:93866620..93866783 GCAAAGGGACTCGTGACTTC Chr16:93866729..93866748 59.85 55
downstream ENSMUSE00000244070 Chr16:93870609..93871497 TCTTCACGCACTTGTCGTTC Chr16:93871213..93871232 60.03 50
downstream ENSMUSE00000244065 Chr16:93873482..93873639 TTTCCCCGTCCACATAACTG Chr16:93873641..93873660 60.74 50
downstream ENSMUSE00000334632 Chr16:93875004..93876317 TATGATCCCAGGCCCATTTA Chr16:93876018..93876037 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTTCAGTAATCGCCTTGC Chr16:93835609..93835629 58.92 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTTTGTTTCAGCGTGACT Chr16:93835604..93835624 59.34 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039456