Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6264
Trapped Gene
AL929440.5 (ENSMUSG00000082953)
Vector Insertion
Chr 2: 8963638 - 8963746
Public Clones CSD157 (baygenomics) A070A08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718757 (Chr2:8963747..8963821 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCGCTCGTTGTTTAGAGG Chr2:8963780..8963799 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718757 (Chr2:8963747..8963821 -)
Downstram Exon
ENSMUSE00000709166 (Chr2:8963540..8963637 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCGCTCGTTGTTTAGAGG Chr2:8963780..8963799 60.01 55 TGCAGTTTGAATAAGCAGCAA Chr2:8963584..8963604 59.64 38.1

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709933 Chr2:8963913..8964111 ACACGGCTGCAGTCTTCTTC Chr2:8963999..8964018 60.6 55
upstream ENSMUSE00000718757 Chr2:8963747..8963821 CCTCGCTCGTTGTTTAGAGG Chr2:8963780..8963799 60.01 55

*** Putative Vector Insertion (Chr 2: 8963638 - 8963746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000709166 Chr2:8963540..8963637 TGCAGTTTGAATAAGCAGCAA Chr2:8963584..8963604 59.64 38.1
downstream ENSMUSE00000715673 Chr2:8962751..8963331 CCGCGGTAAAGAGATCCATA Chr2:8962810..8962829 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000082953