Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6265
Trapped Gene
Taf1a (ENSMUSG00000072258)
Vector Insertion
Chr NT_165754: 364393 - 369257
Public Clones YHC108 (baygenomics) CSD168 (baygenomics) CSD192 (baygenomics) A069C02 (ggtc)
IST12544B12 (tigm) IST13342G5 (tigm) IST11407D6 (tigm) IST13796D8 (tigm)
Private Clones OST215869 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000628382 (ChrNT_165754:364269..364392 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAAACGTCGGTGCTCTCT ChrNT_165754:364324..364343 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000628382 (ChrNT_165754:364269..364392 +)
Downstram Exon
ENSMUSE00000628381 (ChrNT_165754:369258..369427 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAAACGTCGGTGCTCTCT ChrNT_165754:364324..364343 60.59 55 AGCCTGTCTCTTGTCGGTGT ChrNT_165754:369421..369440 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679200 ChrNT_165754:362233..362438 AAGCGCTCGTTAACTGCTTC ChrNT_165754:362308..362327 59.8 50
upstream ENSMUSE00000628382 ChrNT_165754:364269..364392 CAGAAACGTCGGTGCTCTCT ChrNT_165754:364324..364343 60.59 55

*** Putative Vector Insertion (Chr NT_165754: 364393 - 369257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000628381 ChrNT_165754:369258..369427 AGCCTGTCTCTTGTCGGTGT ChrNT_165754:369421..369440 59.91 55
downstream ENSMUSE00000628380 ChrNT_165754:371128..371241 CATTGCTTTTGGGGTGGTAA ChrNT_165754:371182..371201 60.72 45
downstream ENSMUSE00000679197 ChrNT_165754:373951..374149 AGGTTCCTGTTCGCATCATC ChrNT_165754:374018..374037 60.08 50
downstream ENSMUSE00000679196 ChrNT_165754:375968..376098 CGGCGTAAGCGTAATCATCT ChrNT_165754:375994..376013 60.25 50
downstream ENSMUSE00000679195 ChrNT_165754:377675..377833 CGACGGGAACTTCTCATCAT ChrNT_165754:377755..377774 60.07 50
downstream ENSMUSE00000679194 ChrNT_165754:379244..379310 GGGATGGCACAATCTCATGT ChrNT_165754:379271..379290 60.76 50
downstream ENSMUSE00000679193 ChrNT_165754:379892..379983 TTTCCAGGCCGTTATGTTCT ChrNT_165754:379983..380002 59.57 45
downstream ENSMUSE00000679192 ChrNT_165754:381764..381780 No primer for this exon
downstream ENSMUSE00000679191 ChrNT_165754:381915..381929 No primer for this exon
downstream ENSMUSE00000679190 ChrNT_165754:381957..382111 CACTCTTCGCCCAAAAGAAG ChrNT_165754:382048..382067 59.99 50
downstream ENSMUSE00000679189 ChrNT_165754:382583..382701 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTCCCATGGCTTCACAAG ChrNT_165754:364358..364378 59.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATTTCCCATGGCTTCACAA ChrNT_165754:364357..364377 61.81 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072258