Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6267
Trapped Gene
Wdr48 (ENSMUSG00000032512)
Vector Insertion
Chr 9: 119811545 - 119813395
Public Clones CSD197 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000263958 (Chr9:119811404..119811544 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGCAGGTCGAGACTCCAT Chr9:119811494..119811513 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000263958 (Chr9:119811404..119811544 +)
Downstram Exon
ENSMUSE00000263938 (Chr9:119813396..119813474 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGCAGGTCGAGACTCCAT Chr9:119811494..119811513 59.87 55 GCAACAGAGCACGACATCAT Chr9:119813464..119813483 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391940 Chr9:119804013..119804075 No primer for this exon
upstream ENSMUSE00000263958 Chr9:119811404..119811544 ACAGCAGGTCGAGACTCCAT Chr9:119811494..119811513 59.87 55

*** Putative Vector Insertion (Chr 9: 119811545 - 119813395) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000263938 Chr9:119813396..119813474 GCAACAGAGCACGACATCAT Chr9:119813464..119813483 59.87 50
downstream ENSMUSE00000263914 Chr9:119814321..119814403 TTATGCGTCCTGAGTGTGGA Chr9:119814405..119814424 60.26 50
downstream ENSMUSE00000263897 Chr9:119814486..119814615 GCTGACGCTACCAGCTCTTT Chr9:119814541..119814560 59.79 55
downstream ENSMUSE00000220345 Chr9:119816246..119816334 TGGCCAGGCTATAAATGGAG Chr9:119816293..119816312 60.05 50
downstream ENSMUSE00000220340 Chr9:119816804..119816905 AGGCCTTCACATTGTCCGTA Chr9:119816882..119816901 60.52 50
downstream ENSMUSE00000263847 Chr9:119818469..119818693 TTTCCTGTCTCGTCCTCCAG Chr9:119818624..119818643 60.38 55
downstream ENSMUSE00000263823 Chr9:119820142..119820216 AGGGGGATCTGCTGATCTGT Chr9:119820174..119820193 61.02 55
downstream ENSMUSE00000263797 Chr9:119821485..119821587 AATAACTTGGTCGGGCTGTG Chr9:119821586..119821605 59.99 50
downstream ENSMUSE00000220338 Chr9:119822746..119822843 ACATCCCAGTACGCCACATT Chr9:119822839..119822858 60.26 50
downstream ENSMUSE00000220341 Chr9:119825844..119825951 TTTGCCCAAATCTTCCACTT Chr9:119825873..119825892 59.55 40
downstream ENSMUSE00000220347 Chr9:119826229..119826325 CATCCAGGGTAATGGTCAGC Chr9:119826253..119826272 60.34 55
downstream ENSMUSE00000263706 Chr9:119827580..119827675 TTCTTCATCCATGGGAGTCA Chr9:119827659..119827678 59.01 45
downstream ENSMUSE00000263680 Chr9:119828767..119828872 TGAATAGTGTGCGACCTCCA Chr9:119828874..119828893 60.26 50
downstream ENSMUSE00000263652 Chr9:119829675..119829762 GAGAAGCATCGCCTCAGTCT Chr9:119829723..119829742 59.71 55
downstream ENSMUSE00000393876 Chr9:119831736..119831812 CCTGAAGATGCATGAGGTTG Chr9:119831797..119831816 59.24 50
downstream ENSMUSE00000412557 Chr9:119833196..119833385 CTCGTAGACGTGCTCCATCA Chr9:119833259..119833278 60.01 55
downstream ENSMUSE00000346399 Chr9:119833827..119834786 ACAGTTGTCGTGCTGCTCAC Chr9:119834706..119834725 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCGCCTCTTGGACCAGTA Chr9:119811578..119811598 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGTGTCAATCAGCACAAG Chr9:119811525..119811546 59.89 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032512