Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6269
Trapped Gene
Slc25a38 (ENSMUSG00000032519)
Vector Insertion
Chr 9: 120029966 - 120031211
Public Clones CSD220 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220417 (Chr9:120029791..120029965 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTGAGGAGCATCTACTGC Chr9:120029825..120029844 59.97 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220417 (Chr9:120029791..120029965 +)
Downstram Exon
ENSMUSE00000220420 (Chr9:120031212..120031378 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTGAGGAGCATCTACTGC Chr9:120029825..120029844 59.97 60 TCACGTCTGCAGGTTGAGTC Chr9:120031310..120031329 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000351566 Chr9:120019517..120019690 TGCAGTCGCAGGATGTAGAG Chr9:120019650..120019669 60.16 55
upstream ENSMUSE00000528232 Chr9:120025620..120025741 ATCTCCTCAAAACCCGTCTG Chr9:120025696..120025715 59.14 50
upstream ENSMUSE00000372567 Chr9:120026571..120026655 GGTTCGCACAGAAAGTCTCC Chr9:120026610..120026629 59.85 55
upstream ENSMUSE00000220423 Chr9:120029375..120029554 CCCTGGAGTGGGGATCTACT Chr9:120029392..120029411 60.33 60
upstream ENSMUSE00000220417 Chr9:120029791..120029965 CCCTGAGGAGCATCTACTGC Chr9:120029825..120029844 59.97 60

*** Putative Vector Insertion (Chr 9: 120029966 - 120031211) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220420 Chr9:120031212..120031378 TCACGTCTGCAGGTTGAGTC Chr9:120031310..120031329 60.03 55
downstream ENSMUSE00000353169 Chr9:120032760..120033435 AGAGTAGGCAGGTGGCTGAA Chr9:120033165..120033184 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACGGCACAGGTAAGAGTAG Chr9:120029956..120029977 59.95 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr9:120030013..120030033 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032519