Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6298
Trapped Gene
Arnt (ENSMUSG00000015522)
Vector Insertion
Chr 3: 95238325 - 95238484
Public Clones XH863 (baygenomics) LRY042 (baygenomics) XG669 (baygenomics) A031A02 (ggtc)
W024A06 (ggtc) D069C02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662488 (Chr3:95238326..95238483 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662488 (Chr3:95238326..95238483 +)
Downstram Exon
ENSMUSE00000722064 (Chr3:95238350..95238483 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 3: 95238325 - 95238484) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662488 Chr3:95238326..95238483 No primer for this exon
downstream ENSMUSE00000566269 Chr3:95238350..95238483 No primer for this exon
downstream ENSMUSE00000722064 Chr3:95238350..95238483 No primer for this exon
downstream ENSMUSE00000252504 Chr3:95238358..95238483 No primer for this exon
downstream ENSMUSE00000252497 Chr3:95252294..95252405 No primer for this exon
downstream ENSMUSE00000176312 Chr3:95256507..95256551 No primer for this exon
downstream ENSMUSE00000176306 Chr3:95264299..95264343 No primer for this exon
downstream ENSMUSE00000672257 Chr3:95264299..95264790 No primer for this exon
downstream ENSMUSE00000176311 Chr3:95270715..95270759 No primer for this exon
downstream ENSMUSE00000672261 Chr3:95271119..95271133 No primer for this exon
downstream ENSMUSE00000370909 Chr3:95274099..95274312 No primer for this exon
downstream ENSMUSE00000672260 Chr3:95274129..95274312 No primer for this exon
downstream ENSMUSE00000566267 Chr3:95278461..95278674 No primer for this exon
downstream ENSMUSE00000176310 Chr3:95280002..95280104 No primer for this exon
downstream ENSMUSE00000176294 Chr3:95284117..95284182 No primer for this exon
downstream ENSMUSE00000566266 Chr3:95284676..95284761 No primer for this exon
downstream ENSMUSE00000662487 Chr3:95287694..95287770 No primer for this exon
downstream ENSMUSE00000566256 Chr3:95288781..95288915 No primer for this exon
downstream ENSMUSE00000176301 Chr3:95291171..95291245 No primer for this exon
downstream ENSMUSE00000566262 Chr3:95292277..95292428 No primer for this exon
downstream ENSMUSE00000176300 Chr3:95293514..95293624 No primer for this exon
downstream ENSMUSE00000176296 Chr3:95293803..95293878 No primer for this exon
downstream ENSMUSE00000176308 Chr3:95294177..95294300 No primer for this exon
downstream ENSMUSE00000176292 Chr3:95294475..95294577 No primer for this exon
downstream ENSMUSE00000176305 Chr3:95294945..95295092 No primer for this exon
downstream ENSMUSE00000453112 Chr3:95297620..95297782 No primer for this exon
downstream ENSMUSE00000672259 Chr3:95297623..95297737 No primer for this exon
downstream ENSMUSE00000176298 Chr3:95298369..95298535 No primer for this exon
downstream ENSMUSE00000474482 Chr3:95299226..95301159 No primer for this exon
downstream ENSMUSE00000566258 Chr3:95299226..95300210 No primer for this exon
downstream ENSMUSE00000662486 Chr3:95299226..95299493 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCGGTAAGGTGCCTAATCTG Chr3:95238354..95238374 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGGTAAGGTGCCTAATCTG Chr3:95238354..95238374 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015522