Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6305
Trapped Gene
5730601F06Rik (ENSMUSG00000060510)
Vector Insertion
Chr 9: 20312630 - 20325463
Public Clones (sanger) (sanger) (sanger) CSD298 (baygenomics) 3SE224A06 (ggtc)
E040A07 (ggtc) PST23767-NR (escells) IST14590B5 (tigm)
Private Clones OST376671 (lexicon) OST205338 (lexicon) OST91096 (lexicon) OST68887 (lexicon)
OST42983 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441300 (Chr9:20325464..20325563 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTTCGCCATTGGTATCACA Chr9:20325533..20325552 59.93 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441300 (Chr9:20325464..20325563 -)
Downstram Exon
ENSMUSE00000441294 (Chr9:20312463..20312629 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTTCGCCATTGGTATCACA Chr9:20325533..20325552 59.93 40 TGTGGTAGGCATGAGCAGAG Chr9:20312541..20312560 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441314 Chr9:20325788..20325861 CGAGCTCTGAGTCCTTCTCG Chr9:20325832..20325851 60.42 60
upstream ENSMUSE00000441300 Chr9:20325464..20325563 TTTTCGCCATTGGTATCACA Chr9:20325533..20325552 59.93 40

*** Putative Vector Insertion (Chr 9: 20312630 - 20325463) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441294 Chr9:20312463..20312629 TGTGGTAGGCATGAGCAGAG Chr9:20312541..20312560 60.01 55
downstream ENSMUSE00000441285 Chr9:20311172..20311326 ATGCTGATGGTGAAATGTGC Chr9:20311181..20311200 59.53 45
downstream ENSMUSE00000441280 Chr9:20310421..20310509 CACCGTCCCGTCTACCTCTA Chr9:20310426..20310445 60.13 60
downstream ENSMUSE00000539191 Chr9:20309496..20309622 CCAGCATGACCTCTCGGTAT Chr9:20309501..20309520 60.1 55
downstream ENSMUSE00000441248 Chr9:20306485..20306565 CCACCTCGGACTCTTCTTGT Chr9:20306484..20306503 59.3 55
downstream ENSMUSE00000472341 Chr9:20305318..20305397 CTGTTGCACTGGAACTTTGC Chr9:20305301..20305320 59.49 50
downstream ENSMUSE00000441241 Chr9:20304121..20304921 TGACTTTGCATGCTCACCTC Chr9:20304772..20304791 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATGTAATCGCCTTGCAGCAC Chr9:20322395..20322416 61.17 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATGGCGTGACTGGGAAAAC Chr9:20325397..20325417 60.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATCTAATCGCCTTGCAGCAC Chr9:20325496..20325517 60.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CACCCCCAAGGAGTTGTTAC Chr9:20319583..20319603 59.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060510