Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6307
Trapped Gene
Cox4i1 (ENSMUSG00000031818)
Vector Insertion
Chr 8: 123193283 - 123196624
Public Clones (sanger) (sanger) CSD303 (baygenomics) XH798 (baygenomics) D003B07 (ggtc)
P147E03 (ggtc) P094F05 (ggtc) E123H11 (ggtc) D004H09 (ggtc) M069A04 (ggtc)
D003B07 (ggtc) D016E07 (ggtc) P094F05 (ggtc) P093D05 (ggtc) D016E07 (ggtc)
(ggtc) P147E03 (ggtc) P147E03 (ggtc) G047F10 (ggtc) P093D05 (ggtc)
W174D04 (ggtc) D004H09 (ggtc) (ggtc) PST20690-NR (escells) PST23052-NR (escells)
IST12418F7 (tigm) IST14303G10 (tigm) IST10844C2 (tigm)
Private Clones OST462136 (lexicon) OST434506 (lexicon) OST372438 (lexicon) OST341465 (lexicon)
OST312028 (lexicon) OST281680 (lexicon) OST268136 (lexicon) OST220850 (lexicon)
OST190498 (lexicon) OST108465 (lexicon) OST47961 (lexicon) OST47915 (lexicon)
OST43165 (lexicon) OST40099 (lexicon) OST40070 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213317 (Chr8:123193209..123193282 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCTGATTGGCAAGAGAG Chr8:123193230..123193249 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213317 (Chr8:123193209..123193282 +)
Downstram Exon
ENSMUSE00000213318 (Chr8:123196625..123196792 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCTGATTGGCAAGAGAG Chr8:123193230..123193249 60.1 55 GATCAGCGTAAGTGGGGAAA Chr8:123196675..123196694 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000302979 Chr8:123192190..123192255 GAGCACCCCAGGGTGTAGAG Chr8:123192201..123192220 62.03 65
upstream ENSMUSE00000213317 Chr8:123193209..123193282 GAGCCTGATTGGCAAGAGAG Chr8:123193230..123193249 60.1 55

*** Putative Vector Insertion (Chr 8: 123193283 - 123196624) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213318 Chr8:123196625..123196792 GATCAGCGTAAGTGGGGAAA Chr8:123196675..123196694 60.07 50
downstream ENSMUSE00000213319 Chr8:123197121..123197252 TCGTTAAACTGGATGCGGTA Chr8:123197145..123197164 59.18 45
downstream ENSMUSE00000213321 Chr8:123197871..123198107 CCCAGTCACGATCGAAAGTA Chr8:123197912..123197931 58.72 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCAAGAGAGCCATTTCT Chr8:123196239..123196259 59.96 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCAAGAGAGCCATTTCT Chr8:123196239..123196259 59.96 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031818