Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6310
Trapped Gene
Dhx40 (ENSMUSG00000018425)
Vector Insertion
Chr 11: 86590232 - 86598380
Public Clones CSD329 (baygenomics) CMHD-GT_473B5-3 (cmhd) CMHD-GT_452H3-3 (cmhd) IST10379D12 (tigm)
IST12681C11 (tigm) IST10144B7 (tigm) IST11254A5 (tigm) IST10455F9 (tigm)
IST10250H11 (tigm) IST10041D5HMF1 (tigm) IST12681C11 (tigm) IST12331B2 (tigm)
IST12566A6 (tigm) IST10144B7 (tigm) IST10479G7 (tigm) IST10703C7 (tigm)
IST12331B2 (tigm) IST10703C7 (tigm) IST10442E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105483 (Chr11:86598381..86598538 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105483 (Chr11:86598381..86598538 -)
Downstram Exon
ENSMUSE00000105479 (Chr11:86590117..86590231 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709079 Chr11:86620940..86621108 No primer for this exon
upstream ENSMUSE00000709960 Chr11:86620940..86621108 No primer for this exon
upstream ENSMUSE00000361827 Chr11:86619962..86620129 No primer for this exon
upstream ENSMUSE00000586488 Chr11:86619962..86620129 No primer for this exon
upstream ENSMUSE00000404104 Chr11:86617759..86617904 No primer for this exon
upstream ENSMUSE00000586480 Chr11:86617759..86617904 No primer for this exon
upstream ENSMUSE00000269569 Chr11:86614471..86614590 No primer for this exon
upstream ENSMUSE00000577860 Chr11:86613075..86613149 No primer for this exon
upstream ENSMUSE00000269563 Chr11:86612922..86613149 No primer for this exon
upstream ENSMUSE00000269556 Chr11:86612424..86612490 No primer for this exon
upstream ENSMUSE00000269547 Chr11:86611125..86611256 No primer for this exon
upstream ENSMUSE00000497739 Chr11:86606664..86606763 No primer for this exon
upstream ENSMUSE00000494731 Chr11:86602988..86603074 No primer for this exon
upstream ENSMUSE00000105484 Chr11:86602669..86602851 No primer for this exon
upstream ENSMUSE00000105481 Chr11:86599259..86599339 No primer for this exon
upstream ENSMUSE00000105483 Chr11:86598381..86598538 No primer for this exon

*** Putative Vector Insertion (Chr 11: 86590232 - 86598380) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105479 Chr11:86590117..86590231 No primer for this exon
downstream ENSMUSE00000710375 Chr11:86589162..86589270 No primer for this exon
downstream ENSMUSE00000716470 Chr11:86589162..86589270 No primer for this exon
downstream ENSMUSE00000105476 Chr11:86587306..86587400 No primer for this exon
downstream ENSMUSE00000675117 Chr11:86587306..86587400 No primer for this exon
downstream ENSMUSE00000105480 Chr11:86585396..86585465 No primer for this exon
downstream ENSMUSE00000675114 Chr11:86585396..86585465 No primer for this exon
downstream ENSMUSE00000389367 Chr11:86584532..86584760 No primer for this exon
downstream ENSMUSE00000675113 Chr11:86584532..86584760 No primer for this exon
downstream ENSMUSE00000515896 Chr11:86583256..86583763 No primer for this exon
downstream ENSMUSE00000577861 Chr11:86583256..86583763 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTGATCCGTCCATATACAGAAA Chr11:86595404..86595427 59.35 39.13 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGATCCGTCCATATACAGAAA Chr11:86595404..86595427 59.35 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAATAATCGCCTTGCAGCAC Chr11:86595471..86595491 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAAACGTGACTGGGAAAACC Chr11:86595472..86595492 60.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018425