Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6332
Trapped Gene
Sipa1l1 (ENSMUSG00000042700)
Vector Insertion
Chr 12: 83443487 - 83458219
Public Clones YHC319 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468208 (Chr12:83441649..83443486 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGTCATGAGCTGTCCGTA Chr12:83443216..83443235 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468208 (Chr12:83441649..83443486 +)
Downstram Exon
ENSMUSE00000448627 (Chr12:83458220..83458350 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGTCATGAGCTGTCCGTA Chr12:83443216..83443235 60.01 55 TTTTCCCTTCGAATGCTCAC Chr12:83458289..83458308 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471823 Chr12:83270407..83271063 AGTGAGCGGAAAGTCAGTGC Chr12:83270479..83270498 60.6 55
upstream ENSMUSE00000472867 Chr12:83335450..83335515 CAATTTGGACTCACAAGCAAGA Chr12:83335467..83335488 60.28 40.91
upstream ENSMUSE00000653649 Chr12:83392452..83392472 No primer for this exon
upstream ENSMUSE00000447771 Chr12:83412336..83412396 GTGTGGACGCTGCTGTCTTA Chr12:83412350..83412369 60.06 55
upstream ENSMUSE00000468208 Chr12:83441649..83443486 CTCGTCATGAGCTGTCCGTA Chr12:83443216..83443235 60.01 55

*** Putative Vector Insertion (Chr 12: 83443487 - 83458219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000448627 Chr12:83458220..83458350 TTTTCCCTTCGAATGCTCAC Chr12:83458289..83458308 60.19 45
downstream ENSMUSE00000247831 Chr12:83463930..83464118 CCTTGCTCGTCCAGTTTCAT Chr12:83464120..83464139 60.26 50
downstream ENSMUSE00000612143 Chr12:83473355..83473529 ATCCTTTTAGCCGGACTCGT Chr12:83473499..83473518 60.1 50
downstream ENSMUSE00000479751 Chr12:83485638..83485741 ATGGTGGAGACGTGGAACAT Chr12:83485713..83485732 60.25 50
downstream ENSMUSE00000447752 Chr12:83488542..83488699 GATGTTTTTCGGGCTGAATG Chr12:83488631..83488650 60.45 45
downstream ENSMUSE00000447746 Chr12:83497180..83497753 CACCGCTAATGAAGCTCTCC Chr12:83497724..83497743 59.98 55
downstream ENSMUSE00000345516 Chr12:83498333..83498607 GGTTCTACATCCGCCACAAT Chr12:83498442..83498461 59.82 50
downstream ENSMUSE00000447731 Chr12:83503897..83504166 AGATGCTTCGAGGGATGTTG Chr12:83504141..83504160 60.22 50
downstream ENSMUSE00000447725 Chr12:83517891..83518037 TGGACGAAGACAAGTTGCTG Chr12:83517988..83518007 60.03 50
downstream ENSMUSE00000447718 Chr12:83521525..83521649 GTGGATTTTCCACTGCCACT Chr12:83521608..83521627 59.97 50
downstream ENSMUSE00000447711 Chr12:83523362..83523480 CCTTCGATACTGCTGGGAGA Chr12:83523397..83523416 60.35 55
downstream ENSMUSE00000447703 Chr12:83526000..83526442 CCCATCGTACCACTTCTCGT Chr12:83526092..83526111 59.99 55
downstream ENSMUSE00000447698 Chr12:83533740..83533979 TCCCACGGAGTTAATGGTTC Chr12:83533965..83533984 59.79 50
downstream ENSMUSE00000447692 Chr12:83534676..83534841 TGAGGCTCGAAGCCTAGTGT Chr12:83534730..83534749 60.16 55
downstream ENSMUSE00000447685 Chr12:83538675..83538921 GTGGAAGTGACTTGGGGAGA Chr12:83538882..83538901 60.09 55
downstream ENSMUSE00000358226 Chr12:83541802..83541948 GCGGCATCTACTAGGTTGGA Chr12:83541937..83541956 60.24 55
downstream ENSMUSE00000275863 Chr12:83547804..83547918 CTCCTCCAGCTGGTCACTGT Chr12:83547889..83547908 60.46 60
downstream ENSMUSE00000371292 Chr12:83550297..83550378 TTCTCGAAGCATTTTCAGCA Chr12:83550369..83550388 59.69 40
downstream ENSMUSE00000683518 Chr12:83550297..83550391 TTCTCGAAGCATTTTCAGCA Chr12:83550369..83550388 59.69 40
downstream ENSMUSE00000412789 Chr12:83550888..83551258 GCTGTGCACTGTCCGATATG Chr12:83551163..83551182 60.3 55
downstream ENSMUSE00000683517 Chr12:83550888..83552769 CCAGGGCAAGTGGTTTTCTA Chr12:83552253..83552272 60.1 50
downstream ENSMUSE00000683520 Chr12:83550888..83552769 CCAGGGCAAGTGGTTTTCTA Chr12:83552253..83552272 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAAAAGCTTAATCGCCTTG Chr12:83446528..83446549 59.15 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCTCTGGCGAATGGAAA Chr12:83446484..83446504 60.15 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042700