Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6355
Trapped Gene
2310007F21Rik (ENSMUSG00000037257)
Vector Insertion
Chr 9: 63450579 - 63464492
Public Clones (sanger) YHC222 (baygenomics) Q001B05 (ggtc) (ggtc)
Private Clones OST333854 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000367734 (Chr9:63450462..63450578 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000367734 (Chr9:63450462..63450578 +)
Downstram Exon
ENSMUSE00000430312 (Chr9:63464493..63464683 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACAAACGCCTGGACTGACTC Chr9:63464664..63464683 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000367734 Chr9:63450462..63450578 No primer for this exon

*** Putative Vector Insertion (Chr 9: 63450579 - 63464492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000430312 Chr9:63464493..63464683 ACAAACGCCTGGACTGACTC Chr9:63464664..63464683 60.31 55
downstream ENSMUSE00000584251 Chr9:63464795..63464891 GAGGAGACGCTGTCAAGACC Chr9:63464823..63464842 59.99 60
downstream ENSMUSE00000359536 Chr9:63465315..63465404 CTTGAGCCTGTTGTCGGTTT Chr9:63465341..63465360 60.29 50
downstream ENSMUSE00000324399 Chr9:63466955..63467038 TCATCACGACATTGGACCAG Chr9:63467035..63467054 60.53 50
downstream ENSMUSE00000324377 Chr9:63483112..63483194 CTCTGCTGATGCAACTCTGC Chr9:63483182..63483201 59.89 55
downstream ENSMUSE00000402032 Chr9:63484191..63484290 CGACAATGCTGTCAACCTGT Chr9:63484293..63484312 59.75 50
downstream ENSMUSE00000324317 Chr9:63486847..63486951 CTCCAGATCACCTCCTCCAG Chr9:63486914..63486933 59.78 60
downstream ENSMUSE00000324294 Chr9:63487400..63487449 TGCATGCAACTTTCTTTGCT Chr9:63487446..63487465 59.61 40
downstream ENSMUSE00000388239 Chr9:63488014..63489696 GGTGGTAAACCCAAGCTCAA Chr9:63489466..63489485 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTTGACCAACAGTGGAAA Chr9:63459578..63459599 60.28 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGTGACTGGGAAAACC Chr9:63459626..63459646 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037257