Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6366
Trapped Gene
Prdx2 (ENSMUSG00000005161)
Vector Insertion
Chr 8: 87495592 - 87497898
Public Clones YHC167 (baygenomics) CMHD-GT_171F11-3 (cmhd) PST329-2 (escells) PST5831-NR (escells)
PST5831-NL (escells)
Private Clones OST27184 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000581310 (Chr8:87495461..87495591 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000581310 (Chr8:87495461..87495591 +)
Downstram Exon
ENSMUSE00000500154 (Chr8:87497899..87498215 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681364 Chr8:87493486..87493661 No primer for this exon
upstream ENSMUSE00000261738 Chr8:87493599..87493661 No primer for this exon
upstream ENSMUSE00000681360 Chr8:87493666..87493907 No primer for this exon
upstream ENSMUSE00000681363 Chr8:87494051..87494243 No primer for this exon
upstream ENSMUSE00000503718 Chr8:87494139..87494243 No primer for this exon
upstream ENSMUSE00000711168 Chr8:87494139..87494243 No primer for this exon
upstream ENSMUSE00000499125 Chr8:87494335..87494488 No primer for this exon
upstream ENSMUSE00000483138 Chr8:87495186..87495308 No primer for this exon
upstream ENSMUSE00000581310 Chr8:87495461..87495591 No primer for this exon

*** Putative Vector Insertion (Chr 8: 87495592 - 87497898) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000500154 Chr8:87497899..87498215 No primer for this exon
downstream ENSMUSE00000681362 Chr8:87497899..87498733 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCCAGCATGAATGTAATC Chr8:87495628..87495648 59.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGCGTGACTGGGAAAAC Chr8:87495638..87495658 60.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005161