Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6384
Trapped Gene
Mtmr7 (ENSMUSG00000039431)
Vector Insertion
Chr 8: 41692276 - 41694247
Public Clones YHC209 (baygenomics) IST11329A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000339782 (Chr8:41694248..41694370 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTATCTGACGGCCACTCAC Chr8:41694293..41694312 59.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000339782 (Chr8:41694248..41694370 -)
Downstram Exon
ENSMUSE00000221657 (Chr8:41692113..41692275 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTATCTGACGGCCACTCAC Chr8:41694293..41694312 59.71 55 TCTTGCAGCGAATAAGCAGA Chr8:41692175..41692194 59.86 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684024 Chr8:41720052..41720110 No primer for this exon
upstream ENSMUSE00000339782 Chr8:41694248..41694370 TGTATCTGACGGCCACTCAC Chr8:41694293..41694312 59.71 55

*** Putative Vector Insertion (Chr 8: 41692276 - 41694247) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221657 Chr8:41692113..41692275 TCTTGCAGCGAATAAGCAGA Chr8:41692175..41692194 59.86 45
downstream ENSMUSE00000221652 Chr8:41682637..41682794 ATCGCTGAGCTGCCAATAAT Chr8:41682633..41682652 59.83 45
downstream ENSMUSE00000221646 Chr8:41675764..41675892 CGATCTGGGGACGTACAGTT Chr8:41675829..41675848 59.99 55
downstream ENSMUSE00000221643 Chr8:41672402..41672536 TCACTTCCAGGATTGGCTTT Chr8:41672411..41672430 59.67 45
downstream ENSMUSE00000221638 Chr8:41666768..41666900 TCCTCATGACGTGGATGTTC Chr8:41666770..41666789 59.48 50
downstream ENSMUSE00000221630 Chr8:41649314..41649423 CAGTCCCCACAGGAAATCAC Chr8:41649355..41649374 60.36 55
downstream ENSMUSE00000221690 Chr8:41647924..41648049 CGGTAGTAAGGGTCCAGCAG Chr8:41647921..41647940 59.75 60
downstream ENSMUSE00000221682 Chr8:41646211..41646260 TGTCCGAAGGAAATCCAGTC Chr8:41646204..41646223 60.05 50
downstream ENSMUSE00000221679 Chr8:41643510..41643710 TGAGTTCTCGCCTCTCCTTC Chr8:41643489..41643508 59.68 55
downstream ENSMUSE00000341869 Chr8:41641835..41641886 AAGGAACCGTGAACCCTTTT Chr8:41641828..41641847 59.84 45
downstream ENSMUSE00000582464 Chr8:41641130..41641270 GCATGGAGCTGTAGGCAGAT Chr8:41641122..41641141 60.39 55
downstream ENSMUSE00000221672 Chr8:41639625..41639751 CCCCTTTTCAAAGCGGTTAT Chr8:41639693..41639712 60.31 45
downstream ENSMUSE00000637227 Chr8:41636455..41637267 GCTGGGCTCACTTTGCTTAC Chr8:41637177..41637196 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCGTGGAAAATGCACCTG Chr8:41694266..41694286 60.89 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTTTCAGGATCGTGACTG Chr8:41694188..41694208 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039431