Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI639
Trapped Gene
Bat2 (ENSMUSG00000024393)
Vector Insertion
Chr 17: 35291542 - 35291736
Public Clones DD0643 (sanger) YTA310 (baygenomics) HMA172 (baygenomics) RRS026 (baygenomics)
A054E06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000141902 (Chr17:35291737..35292005 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGCAGCGCTATCAGTTCT Chr17:35291738..35291757 60.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000141902 (Chr17:35291737..35292005 -)
Downstram Exon
ENSMUSE00000141923 (Chr17:35291411..35291541 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGCAGCGCTATCAGTTCT Chr17:35291738..35291757 60.7 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657443 Chr17:35301680..35301798 No primer for this exon
upstream ENSMUSE00000141917 Chr17:35299817..35299991 CTGCAGGACCCAACGTACTC Chr17:35299946..35299965 60.71 60
upstream ENSMUSE00000141905 Chr17:35299147..35299324 CCTGAAAGCCGAGAACAAAG Chr17:35299226..35299245 59.99 50
upstream ENSMUSE00000141893 Chr17:35298755..35298854 No primer for this exon
upstream ENSMUSE00000141889 Chr17:35298587..35298659 GTTCCAAGCGGGGTAAAGTC Chr17:35298628..35298647 60.86 55
upstream ENSMUSE00000544698 Chr17:35298279..35298422 GTGGAAGGGCATCAAACCTA Chr17:35298403..35298422 59.93 50
upstream ENSMUSE00000277531 Chr17:35297973..35298124 CCGGACTCCAAACTTCATCA Chr17:35298052..35298071 61.03 50
upstream ENSMUSE00000141899 Chr17:35297698..35297777 ACCCCAGGGGCCTTATAGAT Chr17:35297720..35297739 60.88 55
upstream ENSMUSE00000141928 Chr17:35297397..35297539 GTGGGTCGGCCTTCTATTCT Chr17:35297459..35297478 60.46 55
upstream ENSMUSE00000141909 Chr17:35297042..35297132 TCAAATTCAGCGATGAGGAA Chr17:35297080..35297099 59.35 40
upstream ENSMUSE00000141929 Chr17:35296725..35296935 GACAGAGCCAGCTCCTCCTA Chr17:35296796..35296815 59.7 60
upstream ENSMUSE00000141915 Chr17:35295881..35296358 CCCCAGCTCTACCACCTGTA Chr17:35296080..35296099 60.13 60
upstream ENSMUSE00000141896 Chr17:35295338..35295528 GGTCCTGAACCACCAGAAGA Chr17:35295483..35295502 60.09 55
upstream ENSMUSE00000141890 Chr17:35294824..35295124 CCAATGCCTCCAATGAACTT Chr17:35294922..35294941 59.93 45
upstream ENSMUSE00000141903 Chr17:35294293..35294503 AGCTCAGAGCCATTTGAACG Chr17:35294446..35294465 60.54 50
upstream ENSMUSE00000141921 Chr17:35292311..35294152 GTCCTACATCTTGCCGTGGT Chr17:35293549..35293568 60 55
upstream ENSMUSE00000141902 Chr17:35291737..35292005 CCAGCAGCGCTATCAGTTCT Chr17:35291738..35291757 60.7 55

*** Putative Vector Insertion (Chr 17: 35291542 - 35291736) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000141923 Chr17:35291411..35291541 No primer for this exon
downstream ENSMUSE00000141910 Chr17:35291053..35291182 TCAGGCTTAGAGCCCAAGAA Chr17:35291111..35291130 60.09 50
downstream ENSMUSE00000141898 Chr17:35290867..35290952 GGAGCCAGGCTGGTAACTCT Chr17:35290899..35290918 60.79 60
downstream ENSMUSE00000141888 Chr17:35290452..35290685 CAGATGCACTCTCACCAGGA Chr17:35290492..35290511 59.98 55
downstream ENSMUSE00000141907 Chr17:35290170..35290310 TGATCGTTCTGTGCCTATGG Chr17:35290235..35290254 59.67 50
downstream ENSMUSE00000141894 Chr17:35289997..35290068 CTGATGCCACCAACTCCTTT Chr17:35289983..35290002 60.11 50
downstream ENSMUSE00000141892 Chr17:35289563..35289730 GTACGGACGCTGACCTGAAG Chr17:35289583..35289602 60.85 60
downstream ENSMUSE00000141897 Chr17:35287762..35287850 TACTGGTGCAATGAGGGTGT Chr17:35287743..35287762 59.01 50
downstream ENSMUSE00000141936 Chr17:35287443..35287653 ATGGCGGAGGGTAGAGAACT Chr17:35287480..35287499 60.1 55
downstream ENSMUSE00000141919 Chr17:35287173..35287271 CCAGGCTGCAGAGGAGTAGA Chr17:35287194..35287213 60.69 60
downstream ENSMUSE00000141926 Chr17:35286854..35287066 GTGAAGGTAAGACCCGAGCA Chr17:35286870..35286889 60.26 55
downstream ENSMUSE00000141935 Chr17:35286645..35286739 TGCTCAGCTTTCGGTAATCC Chr17:35286669..35286688 60.35 50
downstream ENSMUSE00000141891 Chr17:35286455..35286545 TTGAGACGGGAATTGAGACC Chr17:35286494..35286513 60.05 50
downstream ENSMUSE00000387072 Chr17:35286033..35286346 TAGGGGACTAGGGGAGGAGA Chr17:35286053..35286072 60.02 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATGACTCCATCCCCAAAG Chr17:35291692..35291712 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGACTCCATCCCCAAAG Chr17:35291692..35291712 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024393