Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI641
Trapped Gene
Ywhah (ENSMUSG00000018965)
Vector Insertion
Chr 5: 33361804 - 33369190
Public Clones DD0501 (sanger) (sanger) AX0660 (sanger) E080H04 (ggtc) P116D10 (ggtc)
(ggtc) E080H04 (ggtc) P127C03 (ggtc) (ggtc) CMHD-GT_97H6-3 (cmhd) CMHD-GT_98B4-3 (cmhd)
CMHD-GT_98B8-3 (cmhd) CMHD-GT_269C5-3 (cmhd) CMHD-GT_359H2-3 (cmhd) CMHD-GT_172G12-3 (cmhd)
FHCRC-GT-S13-10C1 (fhcrc) IST12218E12 (tigm) IST14889G6 (tigm) IST10984D10 (tigm)
IST12850D10 (tigm)
Private Clones OST412859 (lexicon) OST273840 (lexicon) OST178994 (lexicon) OST158299 (lexicon)
OST128517 (lexicon) OST128401 (lexicon) OST128385 (lexicon) OST33864 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000449635 (Chr5:33361604..33361803 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000449635 (Chr5:33361604..33361803 +)
Downstram Exon
ENSMUSE00000246330 (Chr5:33369191..33370609 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000449635 Chr5:33361604..33361803 No primer for this exon

*** Putative Vector Insertion (Chr 5: 33361804 - 33369190) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000246330 Chr5:33369191..33370609 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr5:33361852..33361872 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAACTAGGCCTCCGGTGAAT Chr5:33361797..33361817 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018965