Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6410
Trapped Gene
Jmjd1c (ENSMUSG00000037876)
Vector Insertion
Chr 10: 66708905 - 66710758
Public Clones CSA003 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000289650 (Chr10:66708782..66708904 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAATGGCGTCCTCTCAAAA Chr10:66708881..66708900 60.19 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000289650 (Chr10:66708782..66708904 +)
Downstram Exon
ENSMUSE00000289640 (Chr10:66710759..66710898 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAATGGCGTCCTCTCAAAA Chr10:66708881..66708900 60.19 45 CACCAGGGATTTCACTCGAA Chr10:66710842..66710861 61.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000419774 Chr10:66648728..66649059 TGCTTCGTTCTGTGGTCTTG Chr10:66648813..66648832 60.03 50
upstream ENSMUSE00000642903 Chr10:66652484..66652597 GTGCCTTTCAGCCATACCAG Chr10:66652578..66652597 60.66 55
upstream ENSMUSE00000642902 Chr10:66678018..66678123 GCTTAAAGCCCGTACTCAGG Chr10:66678031..66678050 59 55
upstream ENSMUSE00000642884 Chr10:66679731..66679855 CGCACCATGATCGTTATGAA Chr10:66679829..66679848 60.49 45
upstream ENSMUSE00000289838 Chr10:66680786..66680929 ATTACATCACGGCGAAGGTC Chr10:66680879..66680898 59.96 50
upstream ENSMUSE00000289832 Chr10:66681025..66681217 CCAGCAACAGCAACAAAGAA Chr10:66681105..66681124 60.03 45
upstream ENSMUSE00000575821 Chr10:66681702..66683383 TGGAGTGCCTACTGCCTCTT Chr10:66683092..66683111 60.01 55
upstream ENSMUSE00000575819 Chr10:66686757..66686929 GTGACCTCAGCGGATGGTAT Chr10:66686793..66686812 59.96 55
upstream ENSMUSE00000371587 Chr10:66687485..66689667 AGAAGAGGAAAGGCGAGGTC Chr10:66689566..66689585 59.96 55
upstream ENSMUSE00000289729 Chr10:66692596..66692797 AGTGCCGAGAGTGCAGACTT Chr10:66692710..66692729 60.21 55
upstream ENSMUSE00000289722 Chr10:66694720..66694934 CGTTGTCCTGGGTGAAAAAG Chr10:66694911..66694930 60.52 50
upstream ENSMUSE00000289712 Chr10:66696119..66696271 CCACACTGTTCAACGTCCAC Chr10:66696179..66696198 60.05 55
upstream ENSMUSE00000289707 Chr10:66700856..66700945 CCCCATGACCATAAGCATCT Chr10:66700897..66700916 59.77 50
upstream ENSMUSE00000289699 Chr10:66701555..66701682 TTGATGCCATGCACATTCTT Chr10:66701570..66701589 60.08 40
upstream ENSMUSE00000289693 Chr10:66701997..66702207 TCTTGCTGAGCAGAAATCCA Chr10:66702173..66702192 59.67 45
upstream ENSMUSE00000666227 Chr10:66701997..66702177 AGTAGCCCTGGAAGTGCAAG Chr10:66702096..66702115 59.5 55
upstream ENSMUSE00000575817 Chr10:66702610..66702824 CCTACGTGATTTGCTGACCA Chr10:66702728..66702747 59.72 50
upstream ENSMUSE00000289677 Chr10:66703411..66703689 GCCACGGATGAAAGCAATAA Chr10:66703555..66703574 60.97 45
upstream ENSMUSE00000289672 Chr10:66706520..66706688 CCAATGCCAACGTTAAGGAG Chr10:66706641..66706660 60.49 50
upstream ENSMUSE00000289662 Chr10:66707531..66707621 ATCTGGGGAGGACTTCAAGG Chr10:66707586..66707605 60.45 55
upstream ENSMUSE00000289657 Chr10:66708254..66708384 CATTTGCCAGGGTTCTTTGT Chr10:66708327..66708346 59.97 45
upstream ENSMUSE00000666226 Chr10:66708361..66708384 No primer for this exon
upstream ENSMUSE00000289650 Chr10:66708782..66708904 GAAATGGCGTCCTCTCAAAA Chr10:66708881..66708900 60.19 45

*** Putative Vector Insertion (Chr 10: 66708905 - 66710758) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000289640 Chr10:66710759..66710898 CACCAGGGATTTCACTCGAA Chr10:66710842..66710861 61.03 50
downstream ENSMUSE00000289631 Chr10:66712378..66712554 GTCTCTGGCGGAGCTTTCTA Chr10:66712471..66712490 59.72 55
downstream ENSMUSE00000612311 Chr10:66717200..66717331 TCTTCGGTCACCTGAACACA Chr10:66717240..66717259 60.28 50
downstream ENSMUSE00000642890 Chr10:66718196..66719066 CCAACCGCAATTAGGTGTCT Chr10:66718298..66718317 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGCAGCCGTAGGTGATG Chr10:66708919..66708939 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAGCAGCCGTAGGTGATG Chr10:66708919..66708939 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037876