Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6411
Trapped Gene
Dot1l (ENSMUSG00000061589)
Vector Insertion
Chr 10: 80254307 - 80254887
Public Clones CSA004 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665856 (Chr10:80253356..80254306 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGAGCGAGCCTATCAAC Chr10:80253386..80253405 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665856 (Chr10:80253356..80254306 +)
Downstram Exon
ENSMUSE00000574719 (Chr10:80254888..80255483 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGAGCGAGCCTATCAAC Chr10:80253386..80253405 60.12 55 AGCACTGGCTCAGGGTTAGA Chr10:80255197..80255216 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708659 Chr10:80217951..80218269 TCCTACAAAGAGGGGAGCTG Chr10:80218011..80218030 59.42 55
upstream ENSMUSE00000721433 Chr10:80217951..80218269 TCCTACAAAGAGGGGAGCTG Chr10:80218011..80218030 59.42 55
upstream ENSMUSE00000609647 Chr10:80227347..80227390 No primer for this exon
upstream ENSMUSE00000665881 Chr10:80227347..80227390 No primer for this exon
upstream ENSMUSE00000492244 Chr10:80228908..80228982 CCTGATCGACTACGACACCA Chr10:80228959..80228978 59.7 55
upstream ENSMUSE00000665880 Chr10:80228908..80228982 CCTGATCGACTACGACACCA Chr10:80228959..80228978 59.7 55
upstream ENSMUSE00000491314 Chr10:80231350..80231413 CAGCGGCTGTGTGACAAATA Chr10:80231363..80231382 60.87 50
upstream ENSMUSE00000665879 Chr10:80231350..80231413 CAGCGGCTGTGTGACAAATA Chr10:80231363..80231382 60.87 50
upstream ENSMUSE00000609646 Chr10:80233883..80234111 TTCTCCCCTGAGGTGTATGG Chr10:80234009..80234028 59.92 55
upstream ENSMUSE00000665878 Chr10:80233883..80234111 TTCTCCCCTGAGGTGTATGG Chr10:80234009..80234028 59.92 55
upstream ENSMUSE00000609645 Chr10:80235849..80235943 GAGTGGAGAAAGCGGACATC Chr10:80235906..80235925 59.81 55
upstream ENSMUSE00000665877 Chr10:80235849..80235943 GAGTGGAGAAAGCGGACATC Chr10:80235906..80235925 59.81 55
upstream ENSMUSE00000609644 Chr10:80236451..80236513 ACCATGGACCGAGAGTTCAG Chr10:80236451..80236470 60.11 55
upstream ENSMUSE00000665876 Chr10:80236451..80236513 ACCATGGACCGAGAGTTCAG Chr10:80236451..80236470 60.11 55
upstream ENSMUSE00000641647 Chr10:80239571..80239579 No primer for this exon
upstream ENSMUSE00000518173 Chr10:80240301..80240356 TGGAACGAGGTGACTTCCTC Chr10:80240302..80240321 60.24 55
upstream ENSMUSE00000665874 Chr10:80240301..80240356 TGGAACGAGGTGACTTCCTC Chr10:80240302..80240321 60.24 55
upstream ENSMUSE00000511049 Chr10:80241008..80241087 GTCCTGAGGTGGATCACCAG Chr10:80241037..80241056 60.53 60
upstream ENSMUSE00000665873 Chr10:80241008..80241087 GTCCTGAGGTGGATCACCAG Chr10:80241037..80241056 60.53 60
upstream ENSMUSE00000515960 Chr10:80243588..80243656 CGGCAGAATCGTATCCTCAA Chr10:80243589..80243608 61.13 50
upstream ENSMUSE00000665872 Chr10:80243588..80243656 CGGCAGAATCGTATCCTCAA Chr10:80243589..80243608 61.13 50
upstream ENSMUSE00000515074 Chr10:80244113..80244219 ACTGGCAAGCCTGTCTCCTA Chr10:80244172..80244191 60.01 55
upstream ENSMUSE00000665871 Chr10:80244113..80244219 ACTGGCAAGCCTGTCTCCTA Chr10:80244172..80244191 60.01 55
upstream ENSMUSE00000514213 Chr10:80244888..80244929 No primer for this exon
upstream ENSMUSE00000665870 Chr10:80244888..80244929 No primer for this exon
upstream ENSMUSE00000477341 Chr10:80245929..80246036 AGCAGCGAGAGAACAAGAGC Chr10:80245957..80245976 60.04 55
upstream ENSMUSE00000665869 Chr10:80245929..80246036 AGCAGCGAGAGAACAAGAGC Chr10:80245957..80245976 60.04 55
upstream ENSMUSE00000476329 Chr10:80246169..80246400 GCCGAACGCAAGTCTAAGAA Chr10:80246316..80246335 60.52 50
upstream ENSMUSE00000665868 Chr10:80246169..80246400 GCCGAACGCAAGTCTAAGAA Chr10:80246316..80246335 60.52 50
upstream ENSMUSE00000504719 Chr10:80246618..80246731 TCTACCAGCTACCTCCAAGCA Chr10:80246645..80246665 60.02 52.38
upstream ENSMUSE00000665867 Chr10:80246618..80246731 TCTACCAGCTACCTCCAAGCA Chr10:80246645..80246665 60.02 52.38
upstream ENSMUSE00000503962 Chr10:80247310..80247401 ACAAAGACCCCGCAGTACAA Chr10:80247348..80247367 60.55 50
upstream ENSMUSE00000665866 Chr10:80247310..80247401 ACAAAGACCCCGCAGTACAA Chr10:80247348..80247367 60.55 50
upstream ENSMUSE00000502955 Chr10:80247487..80247588 AGGCCCAAAAGGAAGAAATC Chr10:80247539..80247558 59.53 45
upstream ENSMUSE00000665865 Chr10:80247487..80247588 AGGCCCAAAAGGAAGAAATC Chr10:80247539..80247558 59.53 45
upstream ENSMUSE00000479143 Chr10:80247795..80247932 GAAGGACAACAGCGAGCTTC Chr10:80247893..80247912 60.14 55
upstream ENSMUSE00000665864 Chr10:80247795..80247932 GAAGGACAACAGCGAGCTTC Chr10:80247893..80247912 60.14 55
upstream ENSMUSE00000500654 Chr10:80248243..80248368 GAGAACCTGCGGAAAGAGAA Chr10:80248294..80248313 59.55 50
upstream ENSMUSE00000665863 Chr10:80248243..80248368 GAGAACCTGCGGAAAGAGAA Chr10:80248294..80248313 59.55 50
upstream ENSMUSE00000498875 Chr10:80248527..80249011 CTTACGCCTTGAGCTGGACT Chr10:80248670..80248689 59.64 55
upstream ENSMUSE00000665862 Chr10:80248527..80249011 CTTACGCCTTGAGCTGGACT Chr10:80248670..80248689 59.64 55
upstream ENSMUSE00000505713 Chr10:80249099..80249234 GCTTGTCCAACAGCATGAAG Chr10:80249143..80249162 59.44 50
upstream ENSMUSE00000665861 Chr10:80249099..80249234 GCTTGTCCAACAGCATGAAG Chr10:80249143..80249162 59.44 50
upstream ENSMUSE00000498486 Chr10:80249749..80249895 GGAGACCATCACCAGCCTAC Chr10:80249781..80249800 59.53 60
upstream ENSMUSE00000665860 Chr10:80249749..80249895 GGAGACCATCACCAGCCTAC Chr10:80249781..80249800 59.53 60
upstream ENSMUSE00000495770 Chr10:80250579..80250708 AAGCAGACTGGTGCTTCTGC Chr10:80250633..80250652 60.74 55
upstream ENSMUSE00000665859 Chr10:80250579..80250708 AAGCAGACTGGTGCTTCTGC Chr10:80250633..80250652 60.74 55
upstream ENSMUSE00000494707 Chr10:80251260..80251837 CTGGAACACCTAGCCTCAGC Chr10:80251728..80251747 60.01 60
upstream ENSMUSE00000609643 Chr10:80251260..80251837 CTGGAACACCTAGCCTCAGC Chr10:80251728..80251747 60.01 60
upstream ENSMUSE00000501670 Chr10:80252059..80252264 AAGGAACGGCCTCTAGGACT Chr10:80252170..80252189 59.35 55
upstream ENSMUSE00000665858 Chr10:80252059..80252264 AAGGAACGGCCTCTAGGACT Chr10:80252170..80252189 59.35 55
upstream ENSMUSE00000462855 Chr10:80253065..80253129 AAATCTCCCCCGAAGACACT Chr10:80253102..80253121 59.94 50
upstream ENSMUSE00000665857 Chr10:80253065..80253129 AAATCTCCCCCGAAGACACT Chr10:80253102..80253121 59.94 50
upstream ENSMUSE00000461103 Chr10:80253356..80254306 CTTCGAGCGAGCCTATCAAC Chr10:80253386..80253405 60.12 55
upstream ENSMUSE00000665856 Chr10:80253356..80254306 CTTCGAGCGAGCCTATCAAC Chr10:80253386..80253405 60.12 55

*** Putative Vector Insertion (Chr 10: 80254307 - 80254887) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000574719 Chr10:80254888..80255483 AGCACTGGCTCAGGGTTAGA Chr10:80255197..80255216 60.01 55
downstream ENSMUSE00000609640 Chr10:80254888..80255518 AGCACTGGCTCAGGGTTAGA Chr10:80255197..80255216 60.01 55
downstream ENSMUSE00000609639 Chr10:80256252..80257136 CAGGGTTAACAGTGGGGTGT Chr10:80256798..80256817 59.74 55
downstream ENSMUSE00000665875 Chr10:80256252..80257092 CAGGGTTAACAGTGGGGTGT Chr10:80256798..80256817 59.74 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGTTCCCTAATCGCCTTG Chr10:80254349..80254369 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCGTTGGAGGTAGGCAAG Chr10:80254297..80254317 61.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061589