Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI643
Trapped Gene
Eif3h (ENSMUSG00000022312)
Vector Insertion
Chr 15: 51630906 - 51674013
Public Clones DD0474 (sanger) YHD372 (baygenomics) CSG247 (baygenomics) A048F01 (ggtc)
A011E06 (ggtc) IST10877D3 (tigm) IST14734D1 (tigm)
Private Clones OST381099 (lexicon) OST365854 (lexicon) OST360373 (lexicon) OST65875 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000357273 (Chr15:51674014..51674170 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGAGGATGATGCTGACTTT Chr15:51674021..51674040 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000357273 (Chr15:51674014..51674170 -)
Downstram Exon
ENSMUSE00000125475 (Chr15:51630738..51630905 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGAGGATGATGCTGACTTT Chr15:51674021..51674040 60.22 50 CACGTGGAGGTGATCAATGT Chr15:51630822..51630841 59.39 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561580 Chr15:51696884..51697010 No primer for this exon
upstream ENSMUSE00000475697 Chr15:51696872..51697029 CTGTCTGGCTGGAAACATGG Chr15:51697000..51697019 61.65 55
upstream ENSMUSE00000357273 Chr15:51674014..51674170 CGGAGGATGATGCTGACTTT Chr15:51674021..51674040 60.22 50

*** Putative Vector Insertion (Chr 15: 51630906 - 51674013) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000125475 Chr15:51630738..51630905 CACGTGGAGGTGATCAATGT Chr15:51630822..51630841 59.39 50
downstream ENSMUSE00000125471 Chr15:51629159..51629258 GTACGCCTTCAGCGAGAGAG Chr15:51629193..51629212 60.3 60
downstream ENSMUSE00000125476 Chr15:51627934..51628083 GCAAGACTGAGCAATTCGTG Chr15:51627918..51627937 59.6 50
downstream ENSMUSE00000251621 Chr15:51621539..51621659 CTTACTGGTGTTGCGCATGT Chr15:51621538..51621557 59.79 50
downstream ENSMUSE00000251617 Chr15:51619452..51619584 CTCGACTCTGTCGCTGCATA Chr15:51619517..51619536 60.31 55
downstream ENSMUSE00000424372 Chr15:51618110..51618371 GCCTAAGTTTTGGGCAGTGA Chr15:51618294..51618313 60.25 50
downstream ENSMUSE00000649357 Chr15:51618110..51618366 GCCTAAGTTTTGGGCAGTGA Chr15:51618294..51618313 60.25 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAGGCTATGGGCTGCTGTC Chr15:51649991..51650011 60.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTTTCGTGACTGGGAAAA Chr15:51649948..51649968 59.85 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGTGAAACTTGGTTCCTGCT Chr15:51650191..51650211 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGTGAAACTTGGTTCCTGCT Chr15:51650191..51650211 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022312