Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6455
Trapped Gene
C330013J21Rik (ENSMUSG00000074529)
Vector Insertion
Chr 2: 177656201 - 177656393
Public Clones CSA140 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000547059 (Chr2:177656394..177656520 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGGGCTTTGCTTGAGACT Chr2:177656455..177656474 62.54 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000547059 (Chr2:177656394..177656520 -)
Downstram Exon
ENSMUSE00000638706 (Chr2:177656140..177656200 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGGGCTTTGCTTGAGACT Chr2:177656455..177656474 62.54 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678552 Chr2:177660264..177660355 GAGTGCTGCGAGGGTAACTC Chr2:177660289..177660308 60.02 60
upstream ENSMUSE00000547059 Chr2:177656394..177656520 AGGGGGCTTTGCTTGAGACT Chr2:177656455..177656474 62.54 55

*** Putative Vector Insertion (Chr 2: 177656201 - 177656393) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638706 Chr2:177656140..177656200 No primer for this exon
downstream ENSMUSE00000678550 Chr2:177654632..177654860 GCAAAGGCTTTACCACATTGA Chr2:177654776..177654796 60.12 42.86
downstream ENSMUSE00000678551 Chr2:177637767..177638432 GGGGGTCTTTCATTAGCACA Chr2:177638350..177638369 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:177656322..177656342 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000074529