Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI646
Trapped Gene
Got2 (ENSMUSG00000031672)
Vector Insertion
Chr 8: 98401770 - 98412116
Public Clones DD0442 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387897 (Chr8:98412117..98412301 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGATCTCGGCTCTACCAC Chr8:98412232..98412251 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387897 (Chr8:98412117..98412301 -)
Downstram Exon
ENSMUSE00000211651 (Chr8:98401613..98401769 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGATCTCGGCTCTACCAC Chr8:98412232..98412251 59.83 60 TGGAGGTCCCATTTCAACAT Chr8:98401714..98401733 60.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387897 Chr8:98412117..98412301 CCAGATCTCGGCTCTACCAC Chr8:98412232..98412251 59.83 60

*** Putative Vector Insertion (Chr 8: 98401770 - 98412116) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211651 Chr8:98401613..98401769 TGGAGGTCCCATTTCAACAT Chr8:98401714..98401733 60.17 45
downstream ENSMUSE00000211659 Chr8:98399646..98399774 GGGCAGGTATTCTTTGTCCA Chr8:98399705..98399724 59.93 50
downstream ENSMUSE00000211652 Chr8:98398304..98398363 ATGGTCTGCACAGTGACGAA Chr8:98398322..98398341 60.32 50
downstream ENSMUSE00000211650 Chr8:98396076..98396237 GAAGATGGGCGTGTGATTTC Chr8:98396144..98396163 60.47 50
downstream ENSMUSE00000240581 Chr8:98395791..98395895 CTTCACCACGGACGCTATCT Chr8:98395769..98395788 60.28 55
downstream ENSMUSE00000211656 Chr8:98394675..98394825 TGTTCTTGGCATACGATTGG Chr8:98394665..98394684 59.54 45
downstream ENSMUSE00000211655 Chr8:98393372..98393537 TTCCGCAAGTCTGGAGAAGT Chr8:98393356..98393375 59.99 50
downstream ENSMUSE00000211654 Chr8:98390721..98390871 TTAGGCCGGTGAAACAGAAC Chr8:98390710..98390729 60.11 50
downstream ENSMUSE00000417378 Chr8:98388036..98389151 TCTCTCCACGGCTCTTTGAT Chr8:98388301..98388320 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCCGAGGGATACAGAGA Chr8:98406094..98406114 60.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCCGAGGGATACAGAGA Chr8:98406094..98406114 60.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031672