Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6477
Trapped Gene
Agpat4 (ENSMUSG00000023827)
Vector Insertion
Chr 17: 12403659 - 12406320
Public Clones CSC006 (baygenomics) CSC018 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000135584 (Chr17:12403505..12403658 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGTGCTTGCGAGATGTTG Chr17:12403639..12403658 59.6 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000135584 (Chr17:12403505..12403658 +)
Downstram Exon
ENSMUSE00000135586 (Chr17:12406321..12406423 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGTGCTTGCGAGATGTTG Chr17:12403639..12403658 59.6 50 AGCAGTGTTGGGTTTTCATTG Chr17:12406380..12406400 60.02 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336429 Chr17:12312150..12312281 TTGTGAGCACCAATGCAAAG Chr17:12312246..12312265 60.84 45
upstream ENSMUSE00000377093 Chr17:12344558..12344815 AGCTGTTCCGCAAGATCAAT Chr17:12344768..12344787 59.84 45
upstream ENSMUSE00000371130 Chr17:12391618..12391787 TCGTGGTCCTCAATCACAAG Chr17:12391711..12391730 59.68 50
upstream ENSMUSE00000135585 Chr17:12403077..12403238 TGGATGTGGTACTTCGTGGA Chr17:12403128..12403147 59.96 50
upstream ENSMUSE00000135584 Chr17:12403505..12403658 GAAGTGCTTGCGAGATGTTG Chr17:12403639..12403658 59.6 50

*** Putative Vector Insertion (Chr 17: 12403659 - 12406320) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135586 Chr17:12406321..12406423 AGCAGTGTTGGGTTTTCATTG Chr17:12406380..12406400 60.02 42.86
downstream ENSMUSE00000556040 Chr17:12408142..12408217 TGTGTAACCAGGCAGAGCAC Chr17:12408203..12408222 59.9 55
downstream ENSMUSE00000135582 Chr17:12409560..12409758 CCAGAACAACCAGTTGACCA Chr17:12409661..12409680 59.56 50
downstream ENSMUSE00000389483 Chr17:12411851..12412506 CAGTCCGTTTGTTTCCGTTT Chr17:12411947..12411966 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCTTGCGAGATGTTGGTAA Chr17:12403644..12403664 60.4 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTTGCGAGATGTTGGTAA Chr17:12403644..12403664 60.4 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023827