Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6494
Trapped Gene
Rnf4 (ENSMUSG00000029110)
Vector Insertion
Chr 5: 34691393 - 34692198
Public Clones YHC332 (baygenomics) IST10040F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185703 (Chr5:34691313..34691392 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTAGAGCCCGTGGTTGTG Chr5:34691346..34691365 60.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185703 (Chr5:34691313..34691392 +)
Downstram Exon
ENSMUSE00000654188 (Chr5:34692199..34692208 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTAGAGCCCGTGGTTGTG Chr5:34691346..34691365 60.68 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699069 Chr5:34688360..34688368 No primer for this exon
upstream ENSMUSE00000185707 Chr5:34689424..34689550 AACTTCGACCCCTGAGGTTT Chr5:34689495..34689514 59.97 50
upstream ENSMUSE00000185703 Chr5:34691313..34691392 CTTTAGAGCCCGTGGTTGTG Chr5:34691346..34691365 60.68 55

*** Putative Vector Insertion (Chr 5: 34691393 - 34692198) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000654188 Chr5:34692199..34692208 No primer for this exon
downstream ENSMUSE00000185704 Chr5:34692561..34692720 CTCCATCATCCTTGGTGCTT Chr5:34692710..34692729 60.07 50
downstream ENSMUSE00000185702 Chr5:34693439..34693487 No primer for this exon
downstream ENSMUSE00000654187 Chr5:34693880..34696083 TTCAGGCGGAATCATAGGTC Chr5:34694577..34694596 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000029110