Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6516
Trapped Gene
Polr3g (ENSMUSG00000035834)
Vector Insertion
Chr 13: 81821194 - 81826124
Public Clones CSC117 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000248738 (Chr13:81826125..81826175 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAAGAGAGATGATGCCAAG Chr13:81826142..81826162 60.35 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000248738 (Chr13:81826125..81826175 -)
Downstram Exon
ENSMUSE00000248728 (Chr13:81821111..81821193 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAAGAGAGATGATGCCAAG Chr13:81826142..81826162 60.35 47.62 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411101 Chr13:81849857..81850012 GTAGAATCTGCGGCTCCTTG Chr13:81849928..81849947 59.98 55
upstream ENSMUSE00000411409 Chr13:81838743..81838892 AATGGCTGGCAATAAAGGAA Chr13:81838841..81838860 59.55 40
upstream ENSMUSE00000461631 Chr13:81833647..81833776 TGAACCACCCGAAGAAAAAC Chr13:81833650..81833669 59.95 45
upstream ENSMUSE00000248747 Chr13:81828196..81828255 No primer for this exon
upstream ENSMUSE00000248738 Chr13:81826125..81826175 TCCAAGAGAGATGATGCCAAG Chr13:81826142..81826162 60.35 47.62

*** Putative Vector Insertion (Chr 13: 81821194 - 81826124) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248728 Chr13:81821111..81821193 No primer for this exon
downstream ENSMUSE00000248719 Chr13:81817115..81817258 GATCTTTCACCCTCGCCTCT Chr13:81817205..81817224 60.74 55
downstream ENSMUSE00000374931 Chr13:81812836..81815121 TGGATGTAAGCGTTCAGCAG Chr13:81813474..81813493 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr13:81826056..81826076 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAAGCGTGACTGGGAAAA Chr13:81826059..81826079 61.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035834