Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6522
Trapped Gene
OTTMUSG00000016325 (ENSMUSG00000078863)
Vector Insertion
Chr 2: 177569352 - 177574941
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) CSC166 (baygenomics) (ggtc)
(ggtc) 5SE031C01 (ggtc) IST13600F10 (tigm) IST12687H12 (tigm) IST13572E3 (tigm)
IST14889E10 (tigm)
Private Clones OST462911 (lexicon) OST433941 (lexicon) OST433121 (lexicon) OST351200 (lexicon)
OST348609 (lexicon) OST339184 (lexicon) OST332123 (lexicon) OST327169 (lexicon)
OST306527 (lexicon) OST271397 (lexicon) OST269631 (lexicon) OST261568 (lexicon)
OST209023 (lexicon) OST206884 (lexicon) OST195118 (lexicon) OST183359 (lexicon)
OST114393 (lexicon) OST42137 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678568 (Chr2:177574942..177575004 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGTGACTCTACTGGGTGT Chr2:177574981..177575000 59.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678568 (Chr2:177574942..177575004 -)
Downstram Exon
ENSMUSE00000678567 (Chr2:177569225..177569351 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGTGACTCTACTGGGTGT Chr2:177574981..177575000 59.34 55 CAAAGCCCATTCTTCCTGAG Chr2:177569273..177569292 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678563 Chr2:177574942..177575023 TGTGATGTGTTCTGCGTGAC Chr2:177574993..177575012 59.27 50
upstream ENSMUSE00000678568 Chr2:177574942..177575004 TGCGTGACTCTACTGGGTGT Chr2:177574981..177575000 59.34 55

*** Putative Vector Insertion (Chr 2: 177569352 - 177574941) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678567 Chr2:177569225..177569351 CAAAGCCCATTCTTCCTGAG Chr2:177569273..177569292 59.81 50
downstream ENSMUSE00000678566 Chr2:177568956..177569016 No primer for this exon
downstream ENSMUSE00000678565 Chr2:177567362..177567801 AACTCAGAGGGTTGCTCTGC Chr2:177567741..177567760 59.6 55
downstream ENSMUSE00000678561 Chr2:177566496..177567801 TCGGAGATGACTGCTTTGTG Chr2:177566522..177566541 59.98 50
downstream ENSMUSE00000678564 Chr2:177566496..177566857 TCCGGAATGTGTCCGTTTAT Chr2:177566582..177566601 60.19 45
downstream ENSMUSE00000678562 Chr2:177564276..177567801 CATCTTCTGCACGGTTCTCA Chr2:177564954..177564973 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATGGTAAGTGCCAGGTCA Chr2:177571925..177571945 59.01 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACATGGTAAGTGCCAGGTCA Chr2:177571925..177571945 59.01 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCTCATAATCGCCTTGCAG Chr2:177574940..177574960 60.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGGCTTGGAAAACATTCCT Chr2:177571954..177571974 59.94 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078863