Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6524
Trapped Gene
OTTMUSG00000016325 (ENSMUSG00000078863)
Vector Insertion
Chr 2: 177569017 - 177569224
Public Clones CSC168 (baygenomics) W052F04 (ggtc) W088A02 (ggtc)
Private Clones OST193243 (lexicon) OST99188 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678567 (Chr2:177569225..177569351 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTTGCTGGATCCTTCTC Chr2:177569282..177569301 61.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678567 (Chr2:177569225..177569351 -)
Downstram Exon
ENSMUSE00000678566 (Chr2:177568956..177569016 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTTGCTGGATCCTTCTC Chr2:177569282..177569301 61.24 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678563 Chr2:177574942..177575023 TGTGATGTGTTCTGCGTGAC Chr2:177574993..177575012 59.27 50
upstream ENSMUSE00000678568 Chr2:177574942..177575004 TGCGTGACTCTACTGGGTGT Chr2:177574981..177575000 59.34 55
upstream ENSMUSE00000678567 Chr2:177569225..177569351 GGCTTTGCTGGATCCTTCTC Chr2:177569282..177569301 61.24 55

*** Putative Vector Insertion (Chr 2: 177569017 - 177569224) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678566 Chr2:177568956..177569016 No primer for this exon
downstream ENSMUSE00000678565 Chr2:177567362..177567801 AACTCAGAGGGTTGCTCTGC Chr2:177567741..177567760 59.6 55
downstream ENSMUSE00000678561 Chr2:177566496..177567801 TCGGAGATGACTGCTTTGTG Chr2:177566522..177566541 59.98 50
downstream ENSMUSE00000678564 Chr2:177566496..177566857 TCCGGAATGTGTCCGTTTAT Chr2:177566582..177566601 60.19 45
downstream ENSMUSE00000678562 Chr2:177564276..177567801 CATCTTCTGCACGGTTCTCA Chr2:177564954..177564973 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:177569153..177569173 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078863