Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6542
Trapped Gene
Cfdp1 (ENSMUSG00000031954)
Vector Insertion
Chr 8: 114369112 - 114378043
Public Clones YHB054 (baygenomics) YHB052 (baygenomics) IST13047D7 (tigm)
Private Clones OST320506 (lexicon) OST89514 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363488 (Chr8:114378044..114378210 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCTGGTCCTGTACCCCTA Chr8:114378189..114378208 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363488 (Chr8:114378044..114378210 -)
Downstram Exon
ENSMUSE00000214930 (Chr8:114368994..114369111 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCTGGTCCTGTACCCCTA Chr8:114378189..114378208 60.13 60 CACCGTCCACTTCATCTTCC Chr8:114369030..114369049 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363488 Chr8:114378044..114378210 CTGCTGGTCCTGTACCCCTA Chr8:114378189..114378208 60.13 60

*** Putative Vector Insertion (Chr 8: 114369112 - 114378043) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214930 Chr8:114368994..114369111 CACCGTCCACTTCATCTTCC Chr8:114369030..114369049 60.51 55
downstream ENSMUSE00000214932 Chr8:114365683..114365890 CCAGAGTCTTCCTTGCCATC Chr8:114365809..114365828 59.8 55
downstream ENSMUSE00000214931 Chr8:114364258..114364385 GGCTTATCCAGCTCATCTGC Chr8:114364296..114364315 59.95 55
downstream ENSMUSE00000214935 Chr8:114354770..114354889 TCGCTGGTGAAGTGACAAGA Chr8:114354770..114354789 60.59 50
downstream ENSMUSE00000214933 Chr8:114303151..114303309 TGGATTTCTCAAGGGTGCTC Chr8:114303205..114303224 60.19 50
downstream ENSMUSE00000392401 Chr8:114292373..114292687 GGTCCACTCGATCCAGAAAA Chr8:114292628..114292647 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGTTTCCACCATCCATT Chr8:114378019..114378039 60.17 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGAAGACTTCTCCACATCG Chr8:114378070..114378090 60.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTCTAATCGCCTTGCAGCAC Chr8:114375143..114375163 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TATTTTGCGTGACTGGGAAA Chr8:114375147..114375167 59.16 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031954