Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6576
Trapped Gene
Pin4 (ENSMUSG00000079480)
Vector Insertion
Chr X: 99317081 - 99322355
Public Clones YHB191 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696447 (ChrX:99317007..99317080 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGGGTCCTAAAGGTGGTG ChrX:99317047..99317066 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696447 (ChrX:99317007..99317080 +)
Downstram Exon
ENSMUSE00000696442 (ChrX:99322356..99322475 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGGGTCCTAAAGGTGGTG ChrX:99317047..99317066 59.96 55 TCCATGGCTTCCATGATTTT ChrX:99322408..99322427 60.27 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696449 ChrX:99314835..99314903 AGAGTTCATCCGCCAGCTTA ChrX:99314837..99314856 59.98 50
upstream ENSMUSE00000696447 ChrX:99317007..99317080 TCAGGGTCCTAAAGGTGGTG ChrX:99317047..99317066 59.96 55

*** Putative Vector Insertion (Chr X: 99317081 - 99322355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696442 ChrX:99322356..99322475 TCCATGGCTTCCATGATTTT ChrX:99322408..99322427 60.27 40
downstream ENSMUSE00000696440 ChrX:99322832..99323007 CATGGATCCTCTGGTCATCC ChrX:99322867..99322886 60.29 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTGGCAATGCAGTAAAGGT ChrX:99317064..99317084 60 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGTGCGTGACTGGGAAAA ChrX:99317126..99317146 59.32 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079480