Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI66
Trapped Gene
Ptplad1 (ENSMUSG00000033629)
Vector Insertion
Chr 9: 64852116 - 64853414
Public Clones GC0328 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000250543 (Chr9:64853415..64853579 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATCTGATGCGGAAATGGAG Chr9:64853427..64853446 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000250543 (Chr9:64853415..64853579 -)
Downstram Exon
ENSMUSE00000250525 (Chr9:64852064..64852115 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATCTGATGCGGAAATGGAG Chr9:64853427..64853446 60.04 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371131 Chr9:64869264..64869520 TGGAGACTCAAGTGCTGACG Chr9:64869330..64869349 60.18 55
upstream ENSMUSE00000250569 Chr9:64858281..64858323 CCCTGCTATCAGCATCACAG Chr9:64858302..64858321 59.42 55
upstream ENSMUSE00000250554 Chr9:64854368..64854441 No primer for this exon
upstream ENSMUSE00000250543 Chr9:64853415..64853579 AATCTGATGCGGAAATGGAG Chr9:64853427..64853446 60.04 45

*** Putative Vector Insertion (Chr 9: 64852116 - 64853414) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000250525 Chr9:64852064..64852115 No primer for this exon
downstream ENSMUSE00000250501 Chr9:64848788..64848898 CGCACTGTGAGGTTGACAAA Chr9:64848786..64848805 60.91 50
downstream ENSMUSE00000383853 Chr9:64846002..64846129 CAGCATTGAGGGTTTCCACT Chr9:64846024..64846043 60.11 50
downstream ENSMUSE00000350097 Chr9:64840064..64840176 AATTGCGCTCCAGGAATAAA Chr9:64840053..64840072 59.68 40
downstream ENSMUSE00000393131 Chr9:64838781..64838887 AGCACCTTCCAGTCCATGTC Chr9:64838818..64838837 60.12 55
downstream ENSMUSE00000358452 Chr9:64838124..64838255 CCTTCCCGACTCGTTGAATA Chr9:64838187..64838206 60.07 50
downstream ENSMUSE00000401613 Chr9:64834793..64836336 TGCGCAGTACTTCTCCCTTT Chr9:64835667..64835686 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:64853344..64853364 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTGAGAGCCAAGGTGAG Chr9:64853408..64853428 60.28 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033629