Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6606
Trapped Gene
Supt7l (ENSMUSG00000053134)
Vector Insertion
Chr 5: 31820639 - 31820878
Public Clones YHB379 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444537 (Chr5:31820640..31820877 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGTGAGCGACATCACATT Chr5:31820768..31820787 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444537 (Chr5:31820640..31820877 -)
Downstram Exon
ENSMUSE00000720163 (Chr5:31818872..31820877 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGTGAGCGACATCACATT Chr5:31820768..31820787 59.71 50 GAACACACATGCCACGTTTC Chr5:31819459..31819478 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000601235 Chr5:31828988..31829079 TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60
upstream ENSMUSE00000712125 Chr5:31828988..31829109 TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60
upstream ENSMUSE00000716742 Chr5:31828988..31829104 TAGTCCTCGACTCCGACCTG Chr5:31829030..31829049 60.4 60
upstream ENSMUSE00000716985 Chr5:31827558..31827641 GATGTTTGTTGGACCTGAGGA Chr5:31827584..31827604 59.96 47.62
upstream ENSMUSE00000517139 Chr5:31825027..31825634 AACCGTGTAGCCTCACCATC Chr5:31825254..31825273 60 55
upstream ENSMUSE00000715678 Chr5:31825027..31825431 AACCGTGTAGCCTCACCATC Chr5:31825254..31825273 60 55
upstream ENSMUSE00000719383 Chr5:31825027..31825634 AACCGTGTAGCCTCACCATC Chr5:31825254..31825273 60 55
upstream ENSMUSE00000721760 Chr5:31825027..31825532 AACCGTGTAGCCTCACCATC Chr5:31825254..31825273 60 55
upstream ENSMUSE00000515370 Chr5:31822456..31822780 CTATCAAGCAGTCGCCACAA Chr5:31822707..31822726 60.01 50
upstream ENSMUSE00000444537 Chr5:31820640..31820877 CCTGTGAGCGACATCACATT Chr5:31820768..31820787 59.71 50

*** Putative Vector Insertion (Chr 5: 31820639 - 31820878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000720163 Chr5:31818872..31820877 GAACACACATGCCACGTTTC Chr5:31819459..31819478 60.02 50
downstream ENSMUSE00000713407 Chr5:31817695..31818299 CAGAAACGACGCAAAGTGAA Chr5:31817896..31817915 60.03 45
downstream ENSMUSE00000654693 Chr5:31816952..31818299 CAGAAACGACGCAAAGTGAA Chr5:31817896..31817915 60.03 45
downstream ENSMUSE00000716321 Chr5:31816943..31818299 CAGAAACGACGCAAAGTGAA Chr5:31817896..31817915 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr5:31820810..31820830 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGACGTGACTGGGAAAAC Chr5:31820812..31820832 60.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053134