Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6621
Trapped Gene
Ptges3 (ENSMUSG00000071072)
Vector Insertion
Chr 10: 127512419 - 127513122
Public Clones YHB033 (baygenomics) W034C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000505855 (Chr10:127512394..127512418 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000505855 (Chr10:127512394..127512418 +)
Downstram Exon
ENSMUSE00000665443 (Chr10:127513123..127514034 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAAATCCAGGCGATGACAAC Chr10:127513170..127513189 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665445 Chr10:127496038..127496342 CGCCCCTTTTCCTACACTTT Chr10:127496113..127496132 60.47 50
upstream ENSMUSE00000665444 Chr10:127496067..127496342 CGCCCCTTTTCCTACACTTT Chr10:127496113..127496132 60.47 50
upstream ENSMUSE00000573188 Chr10:127505728..127505841 TGCTTCTGCAAAGTGGTACG Chr10:127505734..127505753 60.05 50
upstream ENSMUSE00000461177 Chr10:127506272..127506341 TTGTCTTGGAGGAAGCGATAA Chr10:127506272..127506292 59.83 42.86
upstream ENSMUSE00000493202 Chr10:127507190..127507288 No primer for this exon
upstream ENSMUSE00000517322 Chr10:127509124..127509213 TGGCTCAGTGTGGACTTCAA Chr10:127509130..127509149 60.44 50
upstream ENSMUSE00000506418 Chr10:127511278..127511340 GATCACATGGGTGGTGATGA Chr10:127511284..127511303 60.19 50
upstream ENSMUSE00000505855 Chr10:127512394..127512418 No primer for this exon

*** Putative Vector Insertion (Chr 10: 127512419 - 127513122) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639522 Chr10:127513123..127514310 AAAATCCAGGCGATGACAAC Chr10:127513170..127513189 59.94 45
downstream ENSMUSE00000665443 Chr10:127513123..127514034 AAAATCCAGGCGATGACAAC Chr10:127513170..127513189 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr10:127512470..127512490 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGGATTCACAAGACAGTGATG Chr10:127512391..127512414 59.13 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071072