Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6642
Trapped Gene
Ints3 (ENSMUSG00000027933)
Vector Insertion
Chr 3: 90228010 - 90236725
Public Clones (sanger) RHA269 (baygenomics) RRT152 (baygenomics) D074E12 (ggtc)
IST11517G2HMF2 (tigm) IST12866D10 (tigm) IST11517G2 (tigm)
Private Clones OST449094 (lexicon) OST432950 (lexicon) OST274133 (lexicon) OST251742 (lexicon)
OST221199 (lexicon) OST163451 (lexicon) OST140904 (lexicon) OST35297 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457149 (Chr3:90236726..90237558 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGTTCCTCTTGCTCCTCGT Chr3:90236955..90236974 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457149 (Chr3:90236726..90237558 -)
Downstram Exon
ENSMUSE00000457133 (Chr3:90227926..90228009 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGTTCCTCTTGCTCCTCGT Chr3:90236955..90236974 59.99 50 CTCATGCACCTTTCCAACCT Chr3:90227968..90227987 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000457149 Chr3:90236726..90237558 TTGTTCCTCTTGCTCCTCGT Chr3:90236955..90236974 59.99 50

*** Putative Vector Insertion (Chr 3: 90228010 - 90236725) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457133 Chr3:90227926..90228009 CTCATGCACCTTTCCAACCT Chr3:90227968..90227987 60.11 50
downstream ENSMUSE00000457126 Chr3:90225658..90225741 No primer for this exon
downstream ENSMUSE00000457121 Chr3:90219415..90219528 GACTCACCAGAGCCAAGTCC Chr3:90219479..90219498 59.84 60
downstream ENSMUSE00000457119 Chr3:90219080..90219164 ACTAGTTCCCGAACCAACCA Chr3:90219117..90219136 59.45 50
downstream ENSMUSE00000457114 Chr3:90217452..90217518 CCAGGACACTTTCTGCCAAC Chr3:90217449..90217468 60.69 55
downstream ENSMUSE00000457109 Chr3:90215123..90215267 No primer for this exon
downstream ENSMUSE00000457105 Chr3:90213920..90214049 GGCCAATCATCAAACATTCC Chr3:90214003..90214022 60.14 45
downstream ENSMUSE00000457100 Chr3:90212424..90212521 AGCTTCGTTTCCATGTCTGG Chr3:90212421..90212440 60.26 50
downstream ENSMUSE00000457096 Chr3:90210096..90210287 TCACAGCGCAGAGACTGACT Chr3:90210180..90210199 59.92 55
downstream ENSMUSE00000304132 Chr3:90208436..90208523 TTTCTGGGCTGAAGAACAGC Chr3:90208435..90208454 60.52 50
downstream ENSMUSE00000304126 Chr3:90207907..90207986 TGATGCATGACCAGGATAGC Chr3:90207940..90207959 59.63 50
downstream ENSMUSE00000304120 Chr3:90207428..90207519 GCCAAGACTCGTTTCTCCAC Chr3:90207406..90207425 59.85 55
downstream ENSMUSE00000304115 Chr3:90207001..90207107 GCATGGACCGAAGCTCTTTA Chr3:90207030..90207049 60.35 50
downstream ENSMUSE00000174429 Chr3:90206230..90206349 GAGGTGGTTGTCCATTTCCA Chr3:90206284..90206303 60.76 50
downstream ENSMUSE00000174433 Chr3:90205765..90205894 TCCTCCACGACAGTCTCCTT Chr3:90205821..90205840 59.83 55
downstream ENSMUSE00000174430 Chr3:90205327..90205381 TAACCTCACACTGGGCCTCT Chr3:90205334..90205353 59.72 55
downstream ENSMUSE00000174432 Chr3:90204990..90205093 ACCTCTTCAGGCAACACCTC Chr3:90204977..90204996 59.31 55
downstream ENSMUSE00000174427 Chr3:90204517..90204561 No primer for this exon
downstream ENSMUSE00000174438 Chr3:90204226..90204345 GAAGCTGCTGTTGTCCTCCT Chr3:90204287..90204306 59.6 55
downstream ENSMUSE00000174434 Chr3:90200300..90200453 GCATAGCAGTCGCACATCAT Chr3:90200305..90200324 59.86 50
downstream ENSMUSE00000174441 Chr3:90199060..90199128 GCCACAATCATGTTCAGCAG Chr3:90199057..90199076 60.27 50
downstream ENSMUSE00000174436 Chr3:90198245..90198320 TGAGTCCTTCCGAAACATGA Chr3:90198239..90198258 59.22 45
downstream ENSMUSE00000174443 Chr3:90197996..90198109 CTGCTCAAACGTTTCCCAGT Chr3:90198056..90198075 60.29 50
downstream ENSMUSE00000174442 Chr3:90197668..90197716 CCGTAGCTGAAGCAGGAGAC Chr3:90197654..90197673 60.16 60
downstream ENSMUSE00000174437 Chr3:90197018..90197185 TGGTGAACTGGTCATCAGGA Chr3:90197099..90197118 60.09 50
downstream ENSMUSE00000304170 Chr3:90196713..90196813 TGCTTGGTGTTGGCTAGGTT Chr3:90196696..90196715 60.69 50
downstream ENSMUSE00000174431 Chr3:90196450..90196522 CTTGTGAGCTTCGTCACAGC Chr3:90196433..90196452 59.78 55
downstream ENSMUSE00000304160 Chr3:90196134..90196290 CTTGGGTGGCTTAGTGGAAG Chr3:90196208..90196227 59.73 55
downstream ENSMUSE00000490758 Chr3:90195915..90196027 TTCGTTTTCGTTTGGTAGGC Chr3:90195963..90195982 60.11 45
downstream ENSMUSE00000395515 Chr3:90195310..90196027 TAATGACCACCGTCCACAGA Chr3:90195593..90195612 59.96 50
downstream ENSMUSE00000488281 Chr3:90195310..90195833 TAATGACCACCGTCCACAGA Chr3:90195593..90195612 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTGCACGGTTCCTTTTCAC Chr3:90233715..90233735 59.98 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTGCACGGTTCCTTTTCAC Chr3:90233715..90233735 59.98 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr3:90234489..90234509 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACTGTGACGTGACTGGGAAA Chr3:90234495..90234515 59.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027933