Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6650
Trapped Gene
Ripk1 (ENSMUSG00000021408)
Vector Insertion
Chr 13: 34113327 - 34118610
Public Clones RHA303 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000117652 (Chr13:34113250..34113326 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000117652 (Chr13:34113250..34113326 +)
Downstram Exon
ENSMUSE00000117648 (Chr13:34118611..34118701 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706294 Chr13:34094266..34094575 No primer for this exon
upstream ENSMUSE00000365904 Chr13:34101470..34101689 No primer for this exon
upstream ENSMUSE00000117649 Chr13:34102414..34102570 No primer for this exon
upstream ENSMUSE00000117651 Chr13:34105119..34105256 No primer for this exon
upstream ENSMUSE00000117655 Chr13:34106995..34107226 No primer for this exon
upstream ENSMUSE00000117654 Chr13:34108866..34109015 No primer for this exon
upstream ENSMUSE00000117652 Chr13:34113250..34113326 No primer for this exon

*** Putative Vector Insertion (Chr 13: 34113327 - 34118610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000117648 Chr13:34118611..34118701 No primer for this exon
downstream ENSMUSE00000117650 Chr13:34119587..34120120 No primer for this exon
downstream ENSMUSE00000117656 Chr13:34121909..34122049 No primer for this exon
downstream ENSMUSE00000381392 Chr13:34124365..34125548 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTAGCAAGTGCCCAGAACA Chr13:34113336..34113356 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTAGCAAGTGCCCAGAACA Chr13:34113336..34113356 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021408