Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6667
Trapped Gene
Cdc5l (ENSMUSG00000023932)
Vector Insertion
Chr 17: 45564992 - 45570339
Public Clones (sanger) RRN290 (baygenomics) RRS699 (baygenomics) RRN298 (baygenomics)
HMA240 (baygenomics) RRT011 (baygenomics) RRN306 (baygenomics) RRU566 (baygenomics)
E125D07 (ggtc) IST13614G3 (tigm)
Private Clones OST179355 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000502094 (Chr17:45570340..45570686 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGCCGTTACTACTTTCTCG Chr17:45570427..45570446 60.04 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000502094 (Chr17:45570340..45570686 -)
Downstram Exon
ENSMUSE00000136462 (Chr17:45564888..45564991 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGCCGTTACTACTTTCTCG Chr17:45570427..45570446 60.04 55 TATGCAGCAATGAGGCAATC Chr17:45564897..45564916 59.8 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502094 Chr17:45570340..45570686 GCGCCGTTACTACTTTCTCG Chr17:45570427..45570446 60.04 55

*** Putative Vector Insertion (Chr 17: 45564992 - 45570339) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136462 Chr17:45564888..45564991 TATGCAGCAATGAGGCAATC Chr17:45564897..45564916 59.8 45
downstream ENSMUSE00000402096 Chr17:45563469..45563630 CCTATGATCGGAGCAATGGT Chr17:45563489..45563508 59.92 50
downstream ENSMUSE00000389518 Chr17:45562801..45562928 CTTAAGCTTTCGGGGGTCAT Chr17:45562846..45562865 60.44 50
downstream ENSMUSE00000543081 Chr17:45561450..45561549 CCTCGGAGAGCATCTCAAGT Chr17:45561504..45561523 59.56 55
downstream ENSMUSE00000136475 Chr17:45556550..45556768 CTGCTCGAAGCTCTCGTCTT Chr17:45556706..45556725 60.03 55
downstream ENSMUSE00000367198 Chr17:45553894..45554038 CCACTGGTTTGGAGGATAGC Chr17:45553924..45553943 59.55 55
downstream ENSMUSE00000607325 Chr17:45552502..45552690 TTCTCAGAGCGATGCTGTTG Chr17:45552518..45552537 60.29 50
downstream ENSMUSE00000136467 Chr17:45550071..45550219 GTGGGGTATTAAGCCCACCT Chr17:45550131..45550150 60.07 55
downstream ENSMUSE00000394171 Chr17:45548777..45548939 GGGTGGCATTAGTGACTGGT Chr17:45548844..45548863 59.85 55
downstream ENSMUSE00000136466 Chr17:45547723..45547887 GTTCCTTCTCGGCATTTTCA Chr17:45547766..45547785 60.19 45
downstream ENSMUSE00000136463 Chr17:45545285..45545365 TCCTTTACACGCTCAGCATC Chr17:45545315..45545334 59.03 50
downstream ENSMUSE00000312815 Chr17:45544745..45544987 TTTCCAGATGGTTCGTAGGG Chr17:45544826..45544845 59.93 50
downstream ENSMUSE00000312798 Chr17:45541543..45541740 CCATGGCTCATTCCTTGTTT Chr17:45541663..45541682 59.93 45
downstream ENSMUSE00000396781 Chr17:45529942..45530154 TTCAAAAGTGCGTAGCTCCA Chr17:45529965..45529984 59.61 45
downstream ENSMUSE00000543072 Chr17:45528841..45529253 ACGGTGCTGGGTAACTTGTC Chr17:45529027..45529046 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGCGTAATCGCCTTGCAG Chr17:45570274..45570294 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCAAAGGGGGAGTGTGGAG Chr17:45567348..45567368 61.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr17:45567617..45567637 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGCGAGAGTTTTGTTTTCCT Chr17:45567672..45567692 59.49 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023932