Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6699
Trapped Gene
Chm (ENSMUSG00000025531)
Vector Insertion
Chr X: 110254396 - 110273112
Public Clones BGC481 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151436 (ChrX:110273113..110273179 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGCCTGAATCCATCATTG ChrX:110273159..110273178 59.6 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151436 (ChrX:110273113..110273179 -)
Downstram Exon
ENSMUSE00000151428 (ChrX:110254323..110254395 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGCCTGAATCCATCATTG ChrX:110273159..110273178 59.6 45 GGCCCAGTTTCCTCCATAGT ChrX:110254346..110254365 60.33 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695401 ChrX:110299050..110299124 TCTCCCTTCGGACTTTGATG ChrX:110299068..110299087 60.19 50
upstream ENSMUSE00000151436 ChrX:110273113..110273179 TCTGCCTGAATCCATCATTG ChrX:110273159..110273178 59.6 45

*** Putative Vector Insertion (Chr X: 110254396 - 110273112) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151428 ChrX:110254323..110254395 GGCCCAGTTTCCTCCATAGT ChrX:110254346..110254365 60.33 55
downstream ENSMUSE00000295488 ChrX:110252945..110253069 TGTTGAATTGTTTTGTCCTTGC ChrX:110252947..110252968 60.02 36.36
downstream ENSMUSE00000295483 ChrX:110229625..110230039 CAGTGCACCAGCTTCTTCAA ChrX:110229978..110229997 60.17 50
downstream ENSMUSE00000151440 ChrX:110226158..110226274 CGAAATGCAAGAATCCTCGT ChrX:110226155..110226174 60.21 45
downstream ENSMUSE00000295473 ChrX:110225538..110225658 CTCATCGGGATGGTCTTCAT ChrX:110225523..110225542 59.89 50
downstream ENSMUSE00000295468 ChrX:110223785..110224010 GCAATTGAGTGCAGGACAAA ChrX:110223904..110223923 59.85 45
downstream ENSMUSE00000151435 ChrX:110193747..110193824 ATTCCACCAAACACAGCACA ChrX:110193779..110193798 60.01 45
downstream ENSMUSE00000151434 ChrX:110185526..110185630 No primer for this exon
downstream ENSMUSE00000295458 ChrX:110183188..110183251 ATCAGGACTGCCCTGGAAAT ChrX:110183206..110183225 60.85 50
downstream ENSMUSE00000295453 ChrX:110178456..110178552 TGACTCTTCTGCTGGCACTG ChrX:110178498..110178517 60.33 55
downstream ENSMUSE00000295450 ChrX:110166671..110166769 No primer for this exon
downstream ENSMUSE00000151438 ChrX:110160945..110161105 GGGCCAGAGCACACATAGAC ChrX:110160960..110160979 60.69 60
downstream ENSMUSE00000653896 ChrX:110154201..110157244 TGATTGCACCAAAAGGATGA ChrX:110155034..110155053 60.05 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTGTGGCCATTTGTGTTCA ChrX:110273126..110273147 60.02 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTTCGTGACTGGGAAAACC ChrX:110273045..110273065 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025531