Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6709
Trapped Gene
Ehbp1 (ENSMUSG00000042302)
Vector Insertion
Chr 11: 21914958 - 21953434
Public Clones HMA423 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000272350 (Chr11:21953435..21953558 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCGCTATCTCATGGACACA Chr11:21953436..21953455 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000272350 (Chr11:21953435..21953558 -)
Downstram Exon
ENSMUSE00000410802 (Chr11:21914858..21914957 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCGCTATCTCATGGACACA Chr11:21953436..21953455 60.22 50 AGGAGGGAAAGCTGGTTCAT Chr11:21914836..21914855 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349890 Chr11:22185491..22185841 CTTGACTGGGCCATTGATCT Chr11:22185761..22185780 60.07 50
upstream ENSMUSE00000719725 Chr11:22185491..22185841 CTTGACTGGGCCATTGATCT Chr11:22185761..22185780 60.07 50
upstream ENSMUSE00000272480 Chr11:22147973..22148030 TGGTGGTTGTTTGGACAAGA Chr11:22147997..22148016 59.98 45
upstream ENSMUSE00000272471 Chr11:22139146..22139241 GCTGGCAACCTGGAATAAAA Chr11:22139215..22139234 60.07 45
upstream ENSMUSE00000272460 Chr11:22132005..22132058 TCCTCATGCAGAAGAATTTGAA Chr11:22132035..22132056 59.82 36.36
upstream ENSMUSE00000272453 Chr11:22072828..22073009 AAGGTCGTGTCTGCCACTCT Chr11:22072873..22072892 59.91 55
upstream ENSMUSE00000272447 Chr11:22069038..22069177 AGAAGGCGGCAAAAATTACA Chr11:22069039..22069058 59.72 40
upstream ENSMUSE00000272443 Chr11:22051791..22051895 TGTGCCCTCAGCTAAATCAG Chr11:22051806..22051825 59.02 50
upstream ENSMUSE00000272438 Chr11:22051070..22051192 TTGGCCACTGTGAATACCAA Chr11:22051129..22051148 59.96 45
upstream ENSMUSE00000680761 Chr11:22046537..22046703 TGAACCCATTTGATGAACCA Chr11:22046588..22046607 59.75 40
upstream ENSMUSE00000580848 Chr11:22046466..22046703 TGAACCCATTTGATGAACCA Chr11:22046588..22046607 59.75 40
upstream ENSMUSE00000580858 Chr11:22046466..22046628 TGAACCCATTTGATGAACCA Chr11:22046588..22046607 59.75 40
upstream ENSMUSE00000580857 Chr11:22037841..22038060 AGGGGAAACTGAACGGAGAG Chr11:22037978..22037997 60.62 55
upstream ENSMUSE00000272424 Chr11:22001055..22001233 GGCGTGAAAATCACCAACTT Chr11:22001121..22001140 59.98 45
upstream ENSMUSE00000272416 Chr11:22000425..22000473 No primer for this exon
upstream ENSMUSE00000272409 Chr11:21995321..21996202 GAGAGCCTGAACCTCACCAG Chr11:21995924..21995943 59.99 60
upstream ENSMUSE00000272398 Chr11:21989528..21989671 TGTCCAGACAAGAGGAGCTG Chr11:21989642..21989661 59.12 55
upstream ENSMUSE00000272392 Chr11:21968362..21968509 GAGAGAGGGCTCGTCAGCTA Chr11:21968459..21968478 59.85 60
upstream ENSMUSE00000272383 Chr11:21962783..21962890 No primer for this exon
upstream ENSMUSE00000272373 Chr11:21959140..21959264 GGCAAACTTACTCCCCAGTG Chr11:21959184..21959203 59.59 55
upstream ENSMUSE00000272366 Chr11:21956786..21956924 AAGATCTCCGGACTGAACGA Chr11:21956895..21956914 59.8 50
upstream ENSMUSE00000272357 Chr11:21956533..21956630 GGAACTGAGGAGAAGGCAGA Chr11:21956570..21956589 59.53 55
upstream ENSMUSE00000272350 Chr11:21953435..21953558 TCCGCTATCTCATGGACACA Chr11:21953436..21953455 60.22 50

*** Putative Vector Insertion (Chr 11: 21914958 - 21953434) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410802 Chr11:21914858..21914957 AGGAGGGAAAGCTGGTTCAT Chr11:21914836..21914855 60.07 50
downstream ENSMUSE00000272337 Chr11:21913487..21913560 TTCAGCAGCTCATACCTTCG Chr11:21913497..21913516 59.17 50
downstream ENSMUSE00000272333 Chr11:21907086..21907200 GTTCATCCAGCAGGAGCTGT Chr11:21907125..21907144 60.42 55
downstream ENSMUSE00000373769 Chr11:21905831..21906874 TCCCAGGTCACCTTTCAAAC Chr11:21906120..21906139 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGAGGAGGGAAACCGAGT Chr11:21953397..21953417 59.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGAGGAGGGAAACCGAGT Chr11:21953397..21953417 59.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042302