Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6711
Trapped Gene
Canx (ENSMUSG00000020368)
Vector Insertion
Chr 11: 50125287 - 50138994
Public Clones (sanger) XH148 (baygenomics) HMA568 (baygenomics) XK392 (baygenomics)
P118A02 (ggtc) D015H07 (ggtc) P009E09 (ggtc) P097C10 (ggtc) M022E01 (ggtc)
D048F02 (ggtc) P111E07 (ggtc) W194F02 (ggtc) D134H09 (ggtc) M019B05 (ggtc)
D015H07 (ggtc) P092A01 (ggtc) P118A02 (ggtc) M038A03 (ggtc) D048F02 (ggtc)
PST8694-NR (escells) PST1019-2 (escells) PST174-3 (escells) IST14391C11 (tigm)
IST14675B5 (tigm) IST14774B8 (tigm) IST14267E8 (tigm)
Private Clones OST304322 (lexicon) OST292483 (lexicon) OST261970 (lexicon) OST207970 (lexicon)
OST197595 (lexicon) OST171991 (lexicon) OST119397 (lexicon) OST60665 (lexicon)
OST49730 (lexicon) OST42194 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000371309 (Chr11:50138995..50139093 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000371309 (Chr11:50138995..50139093 -)
Downstram Exon
ENSMUSE00000346916 (Chr11:50125106..50125286 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371309 Chr11:50138995..50139093 No primer for this exon

*** Putative Vector Insertion (Chr 11: 50125287 - 50138994) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346916 Chr11:50125106..50125286 No primer for this exon
downstream ENSMUSE00000103860 Chr11:50124296..50124369 No primer for this exon
downstream ENSMUSE00000103866 Chr11:50123874..50123932 No primer for this exon
downstream ENSMUSE00000296570 Chr11:50122290..50122431 No primer for this exon
downstream ENSMUSE00000103859 Chr11:50121812..50121893 No primer for this exon
downstream ENSMUSE00000103857 Chr11:50120972..50121164 No primer for this exon
downstream ENSMUSE00000103855 Chr11:50117828..50118017 No primer for this exon
downstream ENSMUSE00000103853 Chr11:50115260..50115373 No primer for this exon
downstream ENSMUSE00000103851 Chr11:50114400..50114556 No primer for this exon
downstream ENSMUSE00000103856 Chr11:50112631..50112846 No primer for this exon
downstream ENSMUSE00000103848 Chr11:50111619..50111738 No primer for this exon
downstream ENSMUSE00000103868 Chr11:50110776..50110896 No primer for this exon
downstream ENSMUSE00000103840 Chr11:50110560..50110639 No primer for this exon
downstream ENSMUSE00000366044 Chr11:50107971..50109837 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr11:50126923..50126944 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTAGCAATTAGGAAAACACCACT Chr11:50136015..50136039 58.06 37.5 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTTGTTTCTGTTTCCCAGGT Chr11:50127069..50127090 60.52 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTTGTTTCTGTTTCCCAGGT Chr11:50127069..50127090 60.52 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020368