Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI672
Trapped Gene
Dstn (ENSMUSG00000015932)
Vector Insertion
Chr 2: 143741384 - 143764120
Public Clones DC0391 (sanger) XS0743 (sanger) XS0744 (sanger) BA0341 (sanger)
XS0749 (sanger) XS0024 (sanger) AV0021 (sanger) XS0275 (sanger)
(sanger) XS0738 (sanger) AC0204 (sanger) XS0746 (sanger) XS0168 (sanger)
BA0342 (sanger) (sanger) XR0388 (sanger) AV0030 (sanger) LST093 (baygenomics)
P116B01 (ggtc) (ggtc) D139E03 (ggtc) D125E01 (ggtc) D139F03 (ggtc)
D136D12 (ggtc) D139E03 (ggtc) D129F10 (ggtc) IST14562B8 (tigm)
Private Clones OST463454 (lexicon) OST388372 (lexicon) OST320645 (lexicon) OST305318 (lexicon)
OST289671 (lexicon) OST270965 (lexicon) OST264035 (lexicon) OST218527 (lexicon)
OST195540 (lexicon) OST189183 (lexicon) OST177459 (lexicon) OST172868 (lexicon)
OST169084 (lexicon) OST134149 (lexicon) OST81266 (lexicon) OST67874 (lexicon)
OST43176 (lexicon) OST42967 (lexicon) OST21869 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661484 (Chr2:143741347..143741383 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661484 (Chr2:143741347..143741383 +)
Downstram Exon
ENSMUSE00000169438 (Chr2:143764121..143764428 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661484 Chr2:143741347..143741383 No primer for this exon

*** Putative Vector Insertion (Chr 2: 143741384 - 143764120) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169438 Chr2:143764121..143764428 No primer for this exon
downstream ENSMUSE00000557614 Chr2:143765688..143765764 No primer for this exon
downstream ENSMUSE00000661483 Chr2:143767863..143769059 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTAGCTCTCCTCCCGAAGT Chr2:143741348..143741368 59.97 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTAGCTCTCCTCCCGAAGT Chr2:143741348..143741368 59.97 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015932