Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6723
Trapped Gene
Hic2 (ENSMUSG00000050240)
Vector Insertion
Chr 16: 17233824 - 17255060
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) NPX381 (baygenomics) HMA445 (baygenomics)
3SE284H09 (ggtc) (ggtc) (ggtc) P066H08 (ggtc) P127A10 (ggtc)
P098D02 (ggtc) E063D09 (ggtc) D082D05 (ggtc) D044F09 (ggtc) D024G06 (ggtc)
D006E01 (ggtc) (ggtc) (ggtc) D043B01 (ggtc) P151G07 (ggtc) P101E10 (ggtc)
E125B09 (ggtc) D162D09 (ggtc) D079H09 (ggtc) D044D02 (ggtc) D008E12 (ggtc)
(ggtc) (ggtc) P089B06 (ggtc) P132E06 (ggtc) P099B02 (ggtc) E065G10 (ggtc)
D141H05 (ggtc) D068E11 (ggtc) D036C02 (ggtc) D006E02 (ggtc) (ggtc)
(ggtc) D067B10 (ggtc) P015A07 (ggtc) P127A09 (ggtc) P098B10 (ggtc)
E055G07 (ggtc) D081H10 (ggtc) D044F09 (ggtc) D024G06 (ggtc) D003A08 (ggtc)
(ggtc) (ggtc) P029G08 (ggtc) P137C04 (ggtc) P101E10 (ggtc) E122B01 (ggtc)
D144E03 (ggtc) D068G12 (ggtc) D043B01 (ggtc) D008B12 (ggtc) 5SE167A03 (ggtc)
(ggtc) (ggtc) M120E06 (ggtc) P127A10 (ggtc) P098D02 (ggtc) E065G10 (ggtc)
D082D05 (ggtc) D060H01 (ggtc) D031D01 (ggtc) D006E01 (ggtc) (ggtc)
(ggtc) H004H06 (ggtc) P151G07 (ggtc) P127A09 (ggtc) P097H07 (ggtc)
E033D05 (ggtc) D081H10 (ggtc) D044D02 (ggtc) D019E05 (ggtc) (ggtc)
(ggtc) P029H09 (ggtc) P132E07 (ggtc) P099D01 (ggtc) E089B04 (ggtc)
D144E03 (ggtc) D068E11 (ggtc) D036C02 (ggtc) D008B12 (ggtc) (cmhd)
IST14698E7 (tigm) IST13923C8 (tigm) IST11643C2 (tigm) IST14390B11 (tigm)
IST12858C3 (tigm) IST14377C10 (tigm) IST14610B5 (tigm) IST15064C3 (tigm)
IST14494D1 (tigm) IST15056G7 (tigm) IST14249C1 (tigm) IST14607D6 (tigm)
IST10034F4 (tigm) IST14940F4 (tigm) IST12680E6 (tigm) IST14217E7 (tigm)
IST14419F9 (tigm) IST14518F12 (tigm) IST14414D4 (tigm) IST10907C11 (tigm)
IST13418B8 (tigm) IST14574A7 (tigm) IST14614B5 (tigm) IST14466H11 (tigm)
IST14635G5 (tigm) IST14398H6 (tigm) IST14277H10 (tigm) IST10982A6 (tigm)
IST11751H8 (tigm)
Private Clones OST452220 (lexicon) OST435021 (lexicon) OST434484 (lexicon) OST426571 (lexicon)
OST426492 (lexicon) OST423577 (lexicon) OST422481 (lexicon) OST401931 (lexicon)
OST345828 (lexicon) OST325246 (lexicon) OST319662 (lexicon) OST315078 (lexicon)
OST315055 (lexicon) OST310577 (lexicon) OST296699 (lexicon) OST296498 (lexicon)
OST292046 (lexicon) OST283994 (lexicon) OST281355 (lexicon) OST278631 (lexicon)
OST275908 (lexicon) OST269755 (lexicon) OST267242 (lexicon) OST264740 (lexicon)
OST238187 (lexicon) OST217810 (lexicon) OST211987 (lexicon) OST210949 (lexicon)
OST208305 (lexicon) OST205656 (lexicon) OST205241 (lexicon) OST193614 (lexicon)
OST181266 (lexicon) OST168611 (lexicon) OST168164 (lexicon) OST132325 (lexicon)
OST119329 (lexicon) OST102861 (lexicon) OST63491 (lexicon) OST46083 (lexicon)
OST40113 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000427983 (Chr16:17233680..17233823 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000427983 (Chr16:17233680..17233823 +)
Downstram Exon
ENSMUSE00000427974 (Chr16:17255061..17255159 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCTCCTCGAGTGCACAGACT Chr16:17255111..17255130 60.61 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000427983 Chr16:17233680..17233823 No primer for this exon

*** Putative Vector Insertion (Chr 16: 17233824 - 17255060) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000427974 Chr16:17255061..17255159 CCTCCTCGAGTGCACAGACT Chr16:17255111..17255130 60.61 60
downstream ENSMUSE00000562482 Chr16:17257428..17263522 GACGGAGTCCACTGAGCTTC Chr16:17262171..17262190 59.99 60
downstream ENSMUSE00000703891 Chr16:17257428..17259025 CCACTACTCCCATTGGTGCT Chr16:17258117..17258136 59.99 55
downstream ENSMUSE00000703890 Chr16:17260688..17260764 ACCTCTGGCTCTGCTGTAGG Chr16:17260765..17260784 59.62 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATCAGAGGGGGCAGGTAT Chr16:17239829..17239849 59.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATCAGAGGGGGCAGGTAT Chr16:17239829..17239849 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050240