Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6726
Trapped Gene
Ranbp3 (ENSMUSG00000002372)
Vector Insertion
Chr 17: 56812835 - 56824963
Public Clones (sanger) (sanger) RHA200 (baygenomics) D028H06 (ggtc) D181B09 (ggtc)
E032D01 (ggtc) D015D12 (ggtc) D181B09 (ggtc) D015D12 (ggtc) IST10465C3 (tigm)
IST14496G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000541491 (Chr17:56812807..56812834 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000541491 (Chr17:56812807..56812834 +)
Downstram Exon
ENSMUSE00000693802 (Chr17:56824964..56824984 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000541491 Chr17:56812807..56812834 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56812835 - 56824963) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693802 Chr17:56824964..56824984 No primer for this exon
downstream ENSMUSE00000693801 Chr17:56825428..56825484 No primer for this exon
downstream ENSMUSE00000427496 Chr17:56825429..56825484 No primer for this exon
downstream ENSMUSE00000427470 Chr17:56836025..56836061 No primer for this exon
downstream ENSMUSE00000427464 Chr17:56836141..56836212 No primer for this exon
downstream ENSMUSE00000427456 Chr17:56840446..56840511 No primer for this exon
downstream ENSMUSE00000427445 Chr17:56840872..56840964 No primer for this exon
downstream ENSMUSE00000427442 Chr17:56842186..56842313 No primer for this exon
downstream ENSMUSE00000378834 Chr17:56844880..56844993 No primer for this exon
downstream ENSMUSE00000139663 Chr17:56846285..56846388 No primer for this exon
downstream ENSMUSE00000139654 Chr17:56846586..56846661 No primer for this exon
downstream ENSMUSE00000139650 Chr17:56847274..56847376 No primer for this exon
downstream ENSMUSE00000139661 Chr17:56847594..56847703 No primer for this exon
downstream ENSMUSE00000139655 Chr17:56848637..56848757 No primer for this exon
downstream ENSMUSE00000139649 Chr17:56849511..56849653 No primer for this exon
downstream ENSMUSE00000139659 Chr17:56850014..56850200 No primer for this exon
downstream ENSMUSE00000139657 Chr17:56850279..56851184 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGAGGGCTTAAGGAAGTAA Chr17:56812792..56812813 60.08 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGAGGGCTTAAGGAAGTAA Chr17:56812792..56812813 60.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002372