Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6727
Trapped Gene
Bpnt1 (ENSMUSG00000026617)
Vector Insertion
Chr 1: 187177942 - 187180356
Public Clones RHA202 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000161054 (Chr1:187177836..187177941 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAAGTCCTGGGTGTAAGA Chr1:187177877..187177896 59.29 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000161054 (Chr1:187177836..187177941 +)
Downstram Exon
ENSMUSE00000686057 (Chr1:187180357..187180660 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAAGTCCTGGGTGTAAGA Chr1:187177877..187177896 59.29 50 TCTGGAACATGGCTTGCATA Chr1:187180480..187180499 60.22 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000403926 Chr1:187156028..187156142 ATTGGACCAGTGGACTTGGA Chr1:187156059..187156078 60.36 50
upstream ENSMUSE00000686071 Chr1:187156059..187156142 ATTGGACCAGTGGACTTGGA Chr1:187156059..187156078 60.36 50
upstream ENSMUSE00000161066 Chr1:187161985..187162111 CTATCGCTCAAAAGGCAGGA Chr1:187162041..187162060 60.48 50
upstream ENSMUSE00000706554 Chr1:187161992..187162111 CTATCGCTCAAAAGGCAGGA Chr1:187162041..187162060 60.48 50
upstream ENSMUSE00000161070 Chr1:187165102..187165206 GCTTGGTGCAGATGAGCATA Chr1:187165136..187165155 59.98 50
upstream ENSMUSE00000161064 Chr1:187169194..187169301 GGGAAGTGGATCAAGAGCTG Chr1:187169207..187169226 59.8 55
upstream ENSMUSE00000161060 Chr1:187170554..187170602 GGTTTGGGTTGACCCCTTAG Chr1:187170559..187170578 60.58 55
upstream ENSMUSE00000161058 Chr1:187172623..187172714 GCATCATCAACCAGCCGTAT Chr1:187172683..187172702 60.9 50
upstream ENSMUSE00000161056 Chr1:187176061..187176258 ACCAGATCCCATAGCAACCA Chr1:187176169..187176188 60.34 50
upstream ENSMUSE00000161054 Chr1:187177836..187177941 TGCAAGTCCTGGGTGTAAGA Chr1:187177877..187177896 59.29 50

*** Putative Vector Insertion (Chr 1: 187177942 - 187180356) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000344053 Chr1:187180357..187181656 TTCCCATGGATGTCTGTCAA Chr1:187180384..187180403 59.89 45
downstream ENSMUSE00000686057 Chr1:187180357..187180660 TCTGGAACATGGCTTGCATA Chr1:187180480..187180499 60.22 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026617