Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6734
Trapped Gene
Spg11 (ENSMUSG00000033396)
Vector Insertion
Chr 2: 121886798 - 121890644
Public Clones RHA216 (baygenomics) CMHD-GT_263C9-3 (cmhd)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000291922 (Chr2:121890645..121891392 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCAGTGAGCTGTCCTTCTC Chr2:121890983..121891002 60.14 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000291922 (Chr2:121890645..121891392 -)
Downstram Exon
ENSMUSE00000402261 (Chr2:121886658..121886797 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCAGTGAGCTGTCCTTCTC Chr2:121890983..121891002 60.14 60 GTGGAGGTTCTGGGCTACCT Chr2:121886708..121886727 60.51 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000560648 Chr2:121943857..121944122 GGCAGTCTCCAAGTGCTTTC Chr2:121943914..121943933 60 55
upstream ENSMUSE00000400361 Chr2:121940344..121940525 TGACGCAGCCTTATTACACG Chr2:121940392..121940411 59.9 50
upstream ENSMUSE00000349429 Chr2:121938751..121938975 ATCCTACGCGTTGTGTTTCC Chr2:121938882..121938901 60 50
upstream ENSMUSE00000387312 Chr2:121937452..121937644 AGTGGACCTGGCTCTTCTCA Chr2:121937588..121937607 59.99 55
upstream ENSMUSE00000360246 Chr2:121934429..121934566 CAACATCCGGGACACCTACT Chr2:121934546..121934565 59.84 55
upstream ENSMUSE00000403324 Chr2:121933773..121934221 AGGAGCACGTGAAGAGCAGT Chr2:121934008..121934027 60.21 55
upstream ENSMUSE00000597448 Chr2:121929644..121929789 TCAATCCCTATCCACGCTCT Chr2:121929648..121929667 59.65 50
upstream ENSMUSE00000597447 Chr2:121927382..121927514 AAAATCGTCAGCTGGACACA Chr2:121927485..121927504 59.29 45
upstream ENSMUSE00000597446 Chr2:121923837..121923992 AAGTGACTCGGAAACCCAAA Chr2:121923921..121923940 59.57 45
upstream ENSMUSE00000597445 Chr2:121922992..121923167 GAAAGGAGTGGCCATTTTGA Chr2:121923129..121923148 60.05 45
upstream ENSMUSE00000597444 Chr2:121921326..121921502 GCTCAACGACTGGAGGAACT Chr2:121921408..121921427 59.46 55
upstream ENSMUSE00000383109 Chr2:121920194..121920265 No primer for this exon
upstream ENSMUSE00000443378 Chr2:121919152..121919279 GGACACTTCCAGGAAAATGC Chr2:121919173..121919192 59.53 50
upstream ENSMUSE00000443910 Chr2:121918701..121918876 TCTCCGCAGACTAAGTCCAGA Chr2:121918703..121918723 60.14 52.38
upstream ENSMUSE00000514769 Chr2:121917893..121918103 CTCAAGCATCAGCTTGTGGA Chr2:121918026..121918045 60.14 50
upstream ENSMUSE00000517550 Chr2:121913869..121914072 TCCCGGTTCATCCTCTACTG Chr2:121913920..121913939 60.06 55
upstream ENSMUSE00000516093 Chr2:121912599..121912705 GGTTCAATGTCGGCAAGTCT Chr2:121912614..121912633 60.12 50
upstream ENSMUSE00000518857 Chr2:121910631..121910776 TTTGATTCCCACCAATCAGG Chr2:121910714..121910733 60.69 45
upstream ENSMUSE00000477496 Chr2:121909136..121909297 GAAAGTGGACCCCCAGCTAC Chr2:121909243..121909262 60.88 60
upstream ENSMUSE00000480385 Chr2:121907591..121907657 No primer for this exon
upstream ENSMUSE00000479769 Chr2:121905969..121906134 GTCAGCTCCCACACTTTTCC Chr2:121906106..121906125 59.7 55
upstream ENSMUSE00000482625 Chr2:121901031..121901236 ATGCTCGTTCCAGCTTCATC Chr2:121901044..121901063 60.37 50
upstream ENSMUSE00000481554 Chr2:121900240..121900348 TCTAAGCTTGCTGACGGTGA Chr2:121900318..121900337 59.74 50
upstream ENSMUSE00000444002 Chr2:121898582..121898741 GAAGCTGAGCGTGTCCTACC Chr2:121898659..121898678 60.02 60
upstream ENSMUSE00000443982 Chr2:121897791..121898045 TGTCCTTCAGAGCCACTTGA Chr2:121897997..121898016 59.54 50
upstream ENSMUSE00000443976 Chr2:121896601..121896801 CCACACTCTCATCCGAGGTT Chr2:121896618..121896637 60.11 55
upstream ENSMUSE00000443971 Chr2:121895605..121895712 TTCCAGAAAAGCCTTGAAACA Chr2:121895605..121895625 59.85 38.1
upstream ENSMUSE00000443964 Chr2:121894475..121894637 CCAACTGTTTGTTGGCACTG Chr2:121894493..121894512 60.19 50
upstream ENSMUSE00000443961 Chr2:121891981..121892195 GAGAGTGGCCGAGTTAGCAG Chr2:121892013..121892032 60.16 60
upstream ENSMUSE00000291922 Chr2:121890645..121891392 GCCAGTGAGCTGTCCTTCTC Chr2:121890983..121891002 60.14 60

*** Putative Vector Insertion (Chr 2: 121886798 - 121890644) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402261 Chr2:121886658..121886797 GTGGAGGTTCTGGGCTACCT Chr2:121886708..121886727 60.51 60
downstream ENSMUSE00000291912 Chr2:121885907..121886105 CAGCCACTAGTTCAGCCACA Chr2:121885927..121885946 60.05 55
downstream ENSMUSE00000291909 Chr2:121885436..121885573 TTCCTCTGCTGGGTTGAAAG Chr2:121885520..121885539 60.37 50
downstream ENSMUSE00000291905 Chr2:121885158..121885291 TGTGGCACGTGAAGGTAAAG Chr2:121885219..121885238 59.76 50
downstream ENSMUSE00000167238 Chr2:121884079..121884186 TGCTTTTGATGCAGCAAGTC Chr2:121884094..121884113 60.14 45
downstream ENSMUSE00000167247 Chr2:121881802..121881970 TCAGCTTCAGTTGGATGCAG Chr2:121881798..121881817 60.14 50
downstream ENSMUSE00000443941 Chr2:121881433..121881521 TTAGTTGGGCTCCATCCTTG Chr2:121881470..121881489 60.07 50
downstream ENSMUSE00000443934 Chr2:121881102..121881257 ACTTGGTGAGCCGGTTACAG Chr2:121881190..121881209 60.17 55
downstream ENSMUSE00000244633 Chr2:121880116..121880267 GCCCAGTCAGGAACAAAGTC Chr2:121880202..121880221 59.7 55
downstream ENSMUSE00000625487 Chr2:121879531..121879796 GTCGGTAGGCTGGTGTTGTT Chr2:121879750..121879769 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACTCATATAGGCTGCCAAA Chr2:121887598..121887619 60.1 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTCATATAGGCTGCCAAA Chr2:121887598..121887619 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033396