Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI6741
Trapped Gene
Zfp780b (ENSMUSG00000063047)
Vector Insertion
Chr 7: 28749889 - 28756641
Public Clones RHA231 (baygenomics) XG296 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636122 (Chr7:28756642..28756740 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGCATTTCCAAGCCAGAT Chr7:28756715..28756734 60.08 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636122 (Chr7:28756642..28756740 -)
Downstram Exon
ENSMUSE00000495731 (Chr7:28744837..28749888 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGCATTTCCAAGCCAGAT Chr7:28756715..28756734 60.08 45 GTTCGTTCCGTGGACAAAGT Chr7:28747807..28747826 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676324 Chr7:28764109..28764158 ATGGCCTACGTCCTCACAGA Chr7:28764109..28764128 60.68 55
upstream ENSMUSE00000676323 Chr7:28761771..28761852 TGTTCCAATGAGACGACAGG Chr7:28761783..28761802 59.68 50
upstream ENSMUSE00000636126 Chr7:28759772..28759804 No primer for this exon
upstream ENSMUSE00000676322 Chr7:28759772..28759824 CCTGAAGAAGAATGGCCAAC Chr7:28759796..28759815 59.67 50
upstream ENSMUSE00000636124 Chr7:28758738..28758864 AGGGATGTGGCTGTTGACTT Chr7:28758830..28758849 59.58 50
upstream ENSMUSE00000636122 Chr7:28756642..28756740 GTTGCATTTCCAAGCCAGAT Chr7:28756715..28756734 60.08 45

*** Putative Vector Insertion (Chr 7: 28749889 - 28756641) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676321 Chr7:28749803..28749888 TGCTTTATGCTCTGTTTGAGGA Chr7:28749782..28749803 60.02 40.91
downstream ENSMUSE00000495731 Chr7:28744837..28749888 GTTCGTTCCGTGGACAAAGT Chr7:28747807..28747826 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGCCCAGGTGAGTAAGAG Chr7:28756629..28756649 60.01 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGCCCAGGTGAGTAAGAG Chr7:28756629..28756649 60.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063047